Incidental Mutation 'R6186:Ndufa8'
ID502152
Institutional Source Beutler Lab
Gene Symbol Ndufa8
Ensembl Gene ENSMUSG00000026895
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8
Synonyms0610033L03Rik
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36036326-36049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36039740 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 118 (V118A)
Ref Sequence ENSEMBL: ENSMUSP00000065352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070112]
Predicted Effect probably benign
Transcript: ENSMUST00000070112
AA Change: V118A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065352
Gene: ENSMUSG00000026895
AA Change: V118A

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:CHCH 78 113 3.6e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Ndufa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ndufa8 APN 2 36044455 missense probably damaging 0.99
IGL02603:Ndufa8 APN 2 36044458 missense probably damaging 1.00
R0322:Ndufa8 UTSW 2 36036622 missense probably benign 0.11
R2161:Ndufa8 UTSW 2 36036515 missense probably damaging 1.00
R2287:Ndufa8 UTSW 2 36036542 missense probably benign 0.36
R3001:Ndufa8 UTSW 2 36036559 missense possibly damaging 0.83
R3002:Ndufa8 UTSW 2 36036559 missense possibly damaging 0.83
R7068:Ndufa8 UTSW 2 36044435 missense possibly damaging 0.95
R8536:Ndufa8 UTSW 2 36049300 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTAGAACATGCCAAGTCCTC -3'
(R):5'- TTTGACATCTCTGCCTGTGG -3'

Sequencing Primer
(F):5'- CCTTTGTCTGGTGAATAGGGACAAC -3'
(R):5'- CTATCTCTGTTTTGTGAGGAGCTATC -3'
Posted On2018-02-27