Incidental Mutation 'R6186:Cyp2a5'
ID502166
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 5
SynonymsCoh
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26835305-26843548 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 26843388 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
Predicted Effect probably benign
Transcript: ENSMUST00000005685
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165641
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169007
AA Change: C127R
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547
AA Change: C127R

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170631
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26837103 missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26841009 missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26843046 missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26835874 missense probably damaging 0.99
PIT4696001:Cyp2a5 UTSW 7 26840979 missense probably benign 0.18
R0762:Cyp2a5 UTSW 7 26838873 nonsense probably null
R0980:Cyp2a5 UTSW 7 26839006 splice site probably null
R1078:Cyp2a5 UTSW 7 26835541 missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26835936 missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26841876 intron probably benign
R1803:Cyp2a5 UTSW 7 26835546 splice site probably null
R1899:Cyp2a5 UTSW 7 26839033 nonsense probably null
R1977:Cyp2a5 UTSW 7 26835922 missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26840475 missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26837103 missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3052:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26841054 missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26835545 critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26841104 missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26835874 missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26842958 missense probably benign 0.09
R5998:Cyp2a5 UTSW 7 26837153 missense probably benign 0.00
R7338:Cyp2a5 UTSW 7 26842947 missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26836783 missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26840478 missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26837118 missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
R7983:Cyp2a5 UTSW 7 26840441 missense probably benign 0.40
R8805:Cyp2a5 UTSW 7 26841105 missense probably damaging 0.99
Z1088:Cyp2a5 UTSW 7 26841107 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26835497 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26836774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACAAGTCAGGGGTTG -3'
(R):5'- TGGAAATACCTCTACACAGGATG -3'

Sequencing Primer
(F):5'- CTTGCAGAGGATATTTCAAAGGTAGC -3'
(R):5'- GATGTGGCAATAGACATGAGCTTTTC -3'
Posted On2018-02-27