Mutagenetix > Incidental Mutation

Incidental Mutation 'R6186:Mast3'

502174

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

044326-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6186 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70785483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 521 (T521A)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: T521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T521A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: T505A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	T	A	5: 94,383,976	Y240N	probably benign	Het
Adgb	A	G	10: 10,422,758	S409P	probably damaging	Het
Adgrg5	T	C	8: 94,934,024	V93A	possibly damaging	Het
Akap8l	C	T	17: 32,333,044	V420I	probably benign	Het
Ankrd36	T	G	11: 5,643,812	D472E	possibly damaging	Het
Apbb1	T	C	7: 105,567,726	E250G	probably damaging	Het
AW549877	C	A	15: 3,986,369	D238Y	possibly damaging	Het
Cacna2d4	G	A	6: 119,281,689	E579K	possibly damaging	Het
Capn7	G	T	14: 31,370,918	G780W	probably damaging	Het
Celsr1	T	C	15: 85,921,193	E2419G	possibly damaging	Het
Cep164	A	T	9: 45,794,109	S363R	probably damaging	Het
Cfap221	T	A	1: 119,934,610	I581F	probably damaging	Het
Cog2	C	A	8: 124,546,686	T588N	probably damaging	Het
Cyp2a5	T	C	7: 26,843,388		probably benign	Het
Cyp2j6	G	C	4: 96,536,086	L145V	probably damaging	Het
Evx1	T	C	6: 52,314,218		probably null	Het
Fam186a	T	C	15: 99,947,325	H346R	unknown	Het
Fam205c	T	C	4: 42,872,000	K125R	possibly damaging	Het
Fam53b	T	A	7: 132,715,716	D399V	possibly damaging	Het
Fcho2	T	A	13: 98,815,083	N9I	probably benign	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fkbpl	T	C	17: 34,646,179	F307S	probably benign	Het
Fn1	A	G	1: 71,637,290	I594T	probably damaging	Het
Inpp4b	T	A	8: 82,046,234	V719E	probably damaging	Het
Ldlr	C	T	9: 21,723,759		probably benign	Het
Macf1	A	G	4: 123,484,175	V1419A	probably damaging	Het
Mapkap1	A	G	2: 34,563,114	T340A	possibly damaging	Het
Mark2	A	G	19: 7,283,202	V403A	probably benign	Het
Mkl1	T	C	15: 81,016,652	K546R	probably damaging	Het
Myo1h	C	T	5: 114,319,803	T125I	possibly damaging	Het
Ndufa8	A	G	2: 36,039,740	V118A	probably benign	Het
Nphs1	A	G	7: 30,465,634	T551A	probably damaging	Het
Olfr267	T	C	4: 58,784,948	Y258C	probably damaging	Het
Olfr726	T	A	14: 50,084,525	D52V	probably damaging	Het
Pcm1	T	C	8: 41,293,793	L1343P	probably benign	Het
Pdcd1	T	A	1: 94,040,121	R202*	probably null	Het
Prkab2	A	G	3: 97,663,991		probably null	Het
Ptdss2	T	C	7: 141,154,949		probably benign	Het
Rap1b	G	T	10: 117,820,552	F78L	probably damaging	Het
Rbl2	C	T	8: 91,106,730	T711I	probably damaging	Het
Rhobtb2	A	G	14: 69,798,244	I126T	probably damaging	Het
Rnf123	A	C	9: 108,069,958	S210A	possibly damaging	Het
Shank1	T	A	7: 44,352,566	F1228L	probably benign	Het
Sumo1	C	A	1: 59,644,570	V38L	probably benign	Het
Sycp2	C	T	2: 178,383,560	S363N	probably damaging	Het
Tbx2	G	T	11: 85,837,846	E352*	probably null	Het
Timm44	T	C	8: 4,266,824	N270D	probably damaging	Het
Topaz1	A	T	9: 122,748,826	Q267L	probably benign	Het
Trp63	T	C	16: 25,876,733		probably benign	Het
Ushbp1	T	A	8: 71,391,003	T264S	possibly damaging	Het
Vav3	A	G	3: 109,516,067	Y334C	probably damaging	Het
Wdr36	G	C	18: 32,852,901	A553P	probably benign	Het
Zfhx2	A	T	14: 55,063,160	I2378K	probably damaging	Het
Zfp276	T	A	8: 123,255,933	Y145*	probably null	Het
Zfp458	T	C	13: 67,257,637	E246G	probably damaging	Het
Zfp526	A	G	7: 25,226,136	T607A	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTACACACATGGGAAATGAGGC -3'
(R):5'- CAACCACAGAGTGAGAGGTC -3'

Sequencing Primer
(F):5'- CACATGGGAAATGAGGCTAGCC -3'
(R):5'- GCCACATGAGCAAGACAGTTTTTG -3'

Posted On

2018-02-27