Incidental Mutation 'R6186:Mast3'
ID 502174
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 044326-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71238127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 521 (T521A)
Ref Sequence ENSEMBL: ENSMUSP00000128703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875] [ENSMUST00000212551]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: T521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T521A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: T505A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,298,502 (GRCm39) S409P probably damaging Het
Adgrg5 T C 8: 95,660,652 (GRCm39) V93A possibly damaging Het
Akap8l C T 17: 32,552,018 (GRCm39) V420I probably benign Het
Ankrd36 T G 11: 5,593,812 (GRCm39) D472E possibly damaging Het
Apbb1 T C 7: 105,216,933 (GRCm39) E250G probably damaging Het
Cacna2d4 G A 6: 119,258,650 (GRCm39) E579K possibly damaging Het
Capn7 G T 14: 31,092,875 (GRCm39) G780W probably damaging Het
Celsr1 T C 15: 85,805,394 (GRCm39) E2419G possibly damaging Het
Cep164 A T 9: 45,705,407 (GRCm39) S363R probably damaging Het
Cfap221 T A 1: 119,862,340 (GRCm39) I581F probably damaging Het
Cog2 C A 8: 125,273,425 (GRCm39) T588N probably damaging Het
Cyp2a5 T C 7: 26,542,813 (GRCm39) probably benign Het
Cyp2j6 G C 4: 96,424,323 (GRCm39) L145V probably damaging Het
Evx1 T C 6: 52,291,203 (GRCm39) probably null Het
Fam186a T C 15: 99,845,206 (GRCm39) H346R unknown Het
Fam53b T A 7: 132,317,445 (GRCm39) D399V possibly damaging Het
Fcho2 T A 13: 98,951,591 (GRCm39) N9I probably benign Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fkbpl T C 17: 34,865,153 (GRCm39) F307S probably benign Het
Fn1 A G 1: 71,676,449 (GRCm39) I594T probably damaging Het
Inpp4b T A 8: 82,772,863 (GRCm39) V719E probably damaging Het
Ldlr C T 9: 21,635,055 (GRCm39) probably benign Het
Macf1 A G 4: 123,377,968 (GRCm39) V1419A probably damaging Het
Mapkap1 A G 2: 34,453,126 (GRCm39) T340A possibly damaging Het
Mark2 A G 19: 7,260,567 (GRCm39) V403A probably benign Het
Mrtfa T C 15: 80,900,853 (GRCm39) K546R probably damaging Het
Myo1h C T 5: 114,457,864 (GRCm39) T125I possibly damaging Het
Ndufa8 A G 2: 35,929,752 (GRCm39) V118A probably benign Het
Nphs1 A G 7: 30,165,059 (GRCm39) T551A probably damaging Het
Or2k2 T C 4: 58,784,948 (GRCm39) Y258C probably damaging Het
Or4k15c T A 14: 50,321,982 (GRCm39) D52V probably damaging Het
Pcm1 T C 8: 41,746,830 (GRCm39) L1343P probably benign Het
Pdcd1 T A 1: 93,967,846 (GRCm39) R202* probably null Het
Pramel52-ps T A 5: 94,531,835 (GRCm39) Y240N probably benign Het
Prkab2 A G 3: 97,571,307 (GRCm39) probably null Het
Ptdss2 T C 7: 140,734,862 (GRCm39) probably benign Het
Rap1b G T 10: 117,656,457 (GRCm39) F78L probably damaging Het
Rbl2 C T 8: 91,833,358 (GRCm39) T711I probably damaging Het
Rhobtb2 A G 14: 70,035,693 (GRCm39) I126T probably damaging Het
Rimoc1 C A 15: 4,015,851 (GRCm39) D238Y possibly damaging Het
Rnf123 A C 9: 107,947,157 (GRCm39) S210A possibly damaging Het
Shank1 T A 7: 44,001,990 (GRCm39) F1228L probably benign Het
Spata31f3 T C 4: 42,872,000 (GRCm39) K125R possibly damaging Het
Sumo1 C A 1: 59,683,729 (GRCm39) V38L probably benign Het
Sycp2 C T 2: 178,025,353 (GRCm39) S363N probably damaging Het
Tbx2 G T 11: 85,728,672 (GRCm39) E352* probably null Het
Timm44 T C 8: 4,316,824 (GRCm39) N270D probably damaging Het
Topaz1 A T 9: 122,577,891 (GRCm39) Q267L probably benign Het
Trp63 T C 16: 25,695,483 (GRCm39) probably benign Het
Ushbp1 T A 8: 71,843,647 (GRCm39) T264S possibly damaging Het
Vav3 A G 3: 109,423,383 (GRCm39) Y334C probably damaging Het
Wdr36 G C 18: 32,985,954 (GRCm39) A553P probably benign Het
Zfhx2 A T 14: 55,300,617 (GRCm39) I2378K probably damaging Het
Zfp276 T A 8: 123,982,672 (GRCm39) Y145* probably null Het
Zfp458 T C 13: 67,405,701 (GRCm39) E246G probably damaging Het
Zfp526 A G 7: 24,925,561 (GRCm39) T607A probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTACACACATGGGAAATGAGGC -3'
(R):5'- CAACCACAGAGTGAGAGGTC -3'

Sequencing Primer
(F):5'- CACATGGGAAATGAGGCTAGCC -3'
(R):5'- GCCACATGAGCAAGACAGTTTTTG -3'
Posted On 2018-02-27