Incidental Mutation 'R6186:Inpp4b'
ID 502176
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Name inositol polyphosphate-4-phosphatase, type II
Synonyms E130107I17Rik
MMRRC Submission 044326-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R6186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 82069185-82854543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82772863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 719 (V719E)
Ref Sequence ENSEMBL: ENSMUSP00000148972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000213285] [ENSMUST00000172031] [ENSMUST00000215332] [ENSMUST00000217122]
AlphaFold Q6P1Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000042529
AA Change: V702E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: V702E

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109851
AA Change: V587E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: V587E

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109852
AA Change: V719E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: V719E

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169116
AA Change: V719E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: V719E

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect possibly damaging
Transcript: ENSMUST00000170160
AA Change: V534E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: V534E

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213285
AA Change: V719E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: V719E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: V719E

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: V719E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217122
AA Change: V719E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,298,502 (GRCm39) S409P probably damaging Het
Adgrg5 T C 8: 95,660,652 (GRCm39) V93A possibly damaging Het
Akap8l C T 17: 32,552,018 (GRCm39) V420I probably benign Het
Ankrd36 T G 11: 5,593,812 (GRCm39) D472E possibly damaging Het
Apbb1 T C 7: 105,216,933 (GRCm39) E250G probably damaging Het
Cacna2d4 G A 6: 119,258,650 (GRCm39) E579K possibly damaging Het
Capn7 G T 14: 31,092,875 (GRCm39) G780W probably damaging Het
Celsr1 T C 15: 85,805,394 (GRCm39) E2419G possibly damaging Het
Cep164 A T 9: 45,705,407 (GRCm39) S363R probably damaging Het
Cfap221 T A 1: 119,862,340 (GRCm39) I581F probably damaging Het
Cog2 C A 8: 125,273,425 (GRCm39) T588N probably damaging Het
Cyp2a5 T C 7: 26,542,813 (GRCm39) probably benign Het
Cyp2j6 G C 4: 96,424,323 (GRCm39) L145V probably damaging Het
Evx1 T C 6: 52,291,203 (GRCm39) probably null Het
Fam186a T C 15: 99,845,206 (GRCm39) H346R unknown Het
Fam53b T A 7: 132,317,445 (GRCm39) D399V possibly damaging Het
Fcho2 T A 13: 98,951,591 (GRCm39) N9I probably benign Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fkbpl T C 17: 34,865,153 (GRCm39) F307S probably benign Het
Fn1 A G 1: 71,676,449 (GRCm39) I594T probably damaging Het
Ldlr C T 9: 21,635,055 (GRCm39) probably benign Het
Macf1 A G 4: 123,377,968 (GRCm39) V1419A probably damaging Het
Mapkap1 A G 2: 34,453,126 (GRCm39) T340A possibly damaging Het
Mark2 A G 19: 7,260,567 (GRCm39) V403A probably benign Het
Mast3 T C 8: 71,238,127 (GRCm39) T521A probably damaging Het
Mrtfa T C 15: 80,900,853 (GRCm39) K546R probably damaging Het
Myo1h C T 5: 114,457,864 (GRCm39) T125I possibly damaging Het
Ndufa8 A G 2: 35,929,752 (GRCm39) V118A probably benign Het
Nphs1 A G 7: 30,165,059 (GRCm39) T551A probably damaging Het
Or2k2 T C 4: 58,784,948 (GRCm39) Y258C probably damaging Het
Or4k15c T A 14: 50,321,982 (GRCm39) D52V probably damaging Het
Pcm1 T C 8: 41,746,830 (GRCm39) L1343P probably benign Het
Pdcd1 T A 1: 93,967,846 (GRCm39) R202* probably null Het
Pramel52-ps T A 5: 94,531,835 (GRCm39) Y240N probably benign Het
Prkab2 A G 3: 97,571,307 (GRCm39) probably null Het
Ptdss2 T C 7: 140,734,862 (GRCm39) probably benign Het
Rap1b G T 10: 117,656,457 (GRCm39) F78L probably damaging Het
Rbl2 C T 8: 91,833,358 (GRCm39) T711I probably damaging Het
Rhobtb2 A G 14: 70,035,693 (GRCm39) I126T probably damaging Het
Rimoc1 C A 15: 4,015,851 (GRCm39) D238Y possibly damaging Het
Rnf123 A C 9: 107,947,157 (GRCm39) S210A possibly damaging Het
Shank1 T A 7: 44,001,990 (GRCm39) F1228L probably benign Het
Spata31f3 T C 4: 42,872,000 (GRCm39) K125R possibly damaging Het
Sumo1 C A 1: 59,683,729 (GRCm39) V38L probably benign Het
Sycp2 C T 2: 178,025,353 (GRCm39) S363N probably damaging Het
Tbx2 G T 11: 85,728,672 (GRCm39) E352* probably null Het
Timm44 T C 8: 4,316,824 (GRCm39) N270D probably damaging Het
Topaz1 A T 9: 122,577,891 (GRCm39) Q267L probably benign Het
Trp63 T C 16: 25,695,483 (GRCm39) probably benign Het
Ushbp1 T A 8: 71,843,647 (GRCm39) T264S possibly damaging Het
Vav3 A G 3: 109,423,383 (GRCm39) Y334C probably damaging Het
Wdr36 G C 18: 32,985,954 (GRCm39) A553P probably benign Het
Zfhx2 A T 14: 55,300,617 (GRCm39) I2378K probably damaging Het
Zfp276 T A 8: 123,982,672 (GRCm39) Y145* probably null Het
Zfp458 T C 13: 67,405,701 (GRCm39) E246G probably damaging Het
Zfp526 A G 7: 24,925,561 (GRCm39) T607A probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 82,583,379 (GRCm39) missense probably damaging 1.00
IGL01481:Inpp4b APN 8 82,724,009 (GRCm39) missense probably damaging 1.00
IGL01509:Inpp4b APN 8 82,617,332 (GRCm39) splice site probably benign
IGL01515:Inpp4b APN 8 82,679,340 (GRCm39) missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82,737,292 (GRCm39) missense probably benign 0.03
IGL01643:Inpp4b APN 8 82,798,400 (GRCm39) missense probably damaging 0.97
IGL01736:Inpp4b APN 8 82,723,968 (GRCm39) missense probably benign 0.00
IGL02154:Inpp4b APN 8 82,696,130 (GRCm39) splice site probably benign
IGL02327:Inpp4b APN 8 82,768,591 (GRCm39) missense probably benign 0.01
IGL02413:Inpp4b APN 8 82,759,800 (GRCm39) missense probably benign
IGL02652:Inpp4b APN 8 82,497,429 (GRCm39) splice site probably benign
IGL02678:Inpp4b APN 8 82,583,373 (GRCm39) missense probably damaging 1.00
IGL03146:Inpp4b APN 8 82,470,410 (GRCm39) missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 82,419,639 (GRCm39) intron probably benign
PIT4280001:Inpp4b UTSW 8 82,761,046 (GRCm39) missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82,772,896 (GRCm39) missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82,768,564 (GRCm39) missense probably damaging 1.00
R0083:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 82,497,546 (GRCm39) missense probably benign 0.00
R0285:Inpp4b UTSW 8 82,761,145 (GRCm39) splice site probably benign
R0363:Inpp4b UTSW 8 82,610,886 (GRCm39) splice site probably benign
R0364:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R0471:Inpp4b UTSW 8 82,768,528 (GRCm39) missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 82,723,966 (GRCm39) missense probably benign 0.00
R0562:Inpp4b UTSW 8 82,494,780 (GRCm39) missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R1081:Inpp4b UTSW 8 82,795,653 (GRCm39) missense probably damaging 0.97
R1251:Inpp4b UTSW 8 82,617,382 (GRCm39) missense probably benign 0.01
R1374:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably null
R1445:Inpp4b UTSW 8 82,679,463 (GRCm39) splice site probably null
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1647:Inpp4b UTSW 8 82,583,403 (GRCm39) splice site probably benign
R1754:Inpp4b UTSW 8 82,497,440 (GRCm39) missense probably damaging 1.00
R1759:Inpp4b UTSW 8 82,494,732 (GRCm39) missense probably benign 0.06
R2085:Inpp4b UTSW 8 82,678,903 (GRCm39) missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82,775,118 (GRCm39) missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82,848,004 (GRCm39) nonsense probably null
R2175:Inpp4b UTSW 8 82,583,328 (GRCm39) missense probably damaging 1.00
R2191:Inpp4b UTSW 8 82,723,931 (GRCm39) missense probably damaging 1.00
R2401:Inpp4b UTSW 8 82,723,968 (GRCm39) missense probably benign 0.00
R2475:Inpp4b UTSW 8 82,768,607 (GRCm39) missense probably benign 0.09
R2512:Inpp4b UTSW 8 82,737,179 (GRCm39) missense probably damaging 1.00
R2919:Inpp4b UTSW 8 82,711,958 (GRCm39) missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 82,629,467 (GRCm39) missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 82,678,890 (GRCm39) missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R4590:Inpp4b UTSW 8 82,468,040 (GRCm39) start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 82,696,164 (GRCm39) missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82,849,282 (GRCm39) missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82,849,253 (GRCm39) missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82,759,837 (GRCm39) missense probably damaging 1.00
R5219:Inpp4b UTSW 8 82,610,785 (GRCm39) missense probably benign 0.01
R5228:Inpp4b UTSW 8 82,494,744 (GRCm39) missense probably damaging 0.99
R5557:Inpp4b UTSW 8 82,678,888 (GRCm39) missense probably damaging 0.99
R5627:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably benign
R5691:Inpp4b UTSW 8 82,617,323 (GRCm39) intron probably benign
R6213:Inpp4b UTSW 8 82,724,019 (GRCm39) missense probably damaging 1.00
R6232:Inpp4b UTSW 8 82,678,813 (GRCm39) missense probably damaging 1.00
R6283:Inpp4b UTSW 8 82,497,462 (GRCm39) missense probably damaging 1.00
R6302:Inpp4b UTSW 8 82,494,806 (GRCm39) missense probably benign 0.00
R6309:Inpp4b UTSW 8 82,768,546 (GRCm39) missense probably damaging 1.00
R6360:Inpp4b UTSW 8 82,629,481 (GRCm39) missense probably benign 0.20
R6477:Inpp4b UTSW 8 82,571,343 (GRCm39) splice site probably null
R6773:Inpp4b UTSW 8 82,583,249 (GRCm39) intron probably benign
R6968:Inpp4b UTSW 8 82,571,086 (GRCm39) missense probably benign 0.18
R7147:Inpp4b UTSW 8 82,629,400 (GRCm39) missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82,798,374 (GRCm39) missense probably damaging 1.00
R7409:Inpp4b UTSW 8 82,679,314 (GRCm39) splice site probably null
R7455:Inpp4b UTSW 8 82,798,332 (GRCm39) missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82,772,968 (GRCm39) missense probably damaging 1.00
R7844:Inpp4b UTSW 8 82,467,949 (GRCm39) start gained probably benign
R7958:Inpp4b UTSW 8 82,696,218 (GRCm39) missense probably damaging 1.00
R8440:Inpp4b UTSW 8 82,768,524 (GRCm39) missense probably damaging 1.00
R9160:Inpp4b UTSW 8 82,610,782 (GRCm39) missense possibly damaging 0.55
R9303:Inpp4b UTSW 8 82,759,758 (GRCm39) missense probably damaging 1.00
R9390:Inpp4b UTSW 8 82,497,522 (GRCm39) missense probably damaging 1.00
R9583:Inpp4b UTSW 8 82,497,555 (GRCm39) critical splice donor site probably null
R9705:Inpp4b UTSW 8 82,772,890 (GRCm39) missense probably benign 0.14
R9778:Inpp4b UTSW 8 82,775,160 (GRCm39) missense probably benign
RF003:Inpp4b UTSW 8 82,696,150 (GRCm39) nonsense probably null
Z1088:Inpp4b UTSW 8 82,795,560 (GRCm39) critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82,795,630 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AATGGGTGTATATCCCTTCAGTG -3'
(R):5'- TATGCATATGCCTCCTCCATATACAG -3'

Sequencing Primer
(F):5'- GGTGTATATCCCTTCAGTGATCAGAC -3'
(R):5'- TTCTCAGTCTGCAACAAAAAGAG -3'
Posted On 2018-02-27