Mutagenetix > Incidental Mutation

Incidental Mutation 'R6186:Cog2'

502180

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

044326-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6186 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 124546686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 588 (T588N)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: T588N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: T588N

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	T	A	5: 94,383,976	Y240N	probably benign	Het
Adgb	A	G	10: 10,422,758	S409P	probably damaging	Het
Adgrg5	T	C	8: 94,934,024	V93A	possibly damaging	Het
Akap8l	C	T	17: 32,333,044	V420I	probably benign	Het
Ankrd36	T	G	11: 5,643,812	D472E	possibly damaging	Het
Apbb1	T	C	7: 105,567,726	E250G	probably damaging	Het
AW549877	C	A	15: 3,986,369	D238Y	possibly damaging	Het
Cacna2d4	G	A	6: 119,281,689	E579K	possibly damaging	Het
Capn7	G	T	14: 31,370,918	G780W	probably damaging	Het
Celsr1	T	C	15: 85,921,193	E2419G	possibly damaging	Het
Cep164	A	T	9: 45,794,109	S363R	probably damaging	Het
Cfap221	T	A	1: 119,934,610	I581F	probably damaging	Het
Cyp2a5	T	C	7: 26,843,388		probably benign	Het
Cyp2j6	G	C	4: 96,536,086	L145V	probably damaging	Het
Evx1	T	C	6: 52,314,218		probably null	Het
Fam186a	T	C	15: 99,947,325	H346R	unknown	Het
Fam205c	T	C	4: 42,872,000	K125R	possibly damaging	Het
Fam53b	T	A	7: 132,715,716	D399V	possibly damaging	Het
Fcho2	T	A	13: 98,815,083	N9I	probably benign	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fkbpl	T	C	17: 34,646,179	F307S	probably benign	Het
Fn1	A	G	1: 71,637,290	I594T	probably damaging	Het
Inpp4b	T	A	8: 82,046,234	V719E	probably damaging	Het
Ldlr	C	T	9: 21,723,759		probably benign	Het
Macf1	A	G	4: 123,484,175	V1419A	probably damaging	Het
Mapkap1	A	G	2: 34,563,114	T340A	possibly damaging	Het
Mark2	A	G	19: 7,283,202	V403A	probably benign	Het
Mast3	T	C	8: 70,785,483	T521A	probably damaging	Het
Mkl1	T	C	15: 81,016,652	K546R	probably damaging	Het
Myo1h	C	T	5: 114,319,803	T125I	possibly damaging	Het
Ndufa8	A	G	2: 36,039,740	V118A	probably benign	Het
Nphs1	A	G	7: 30,465,634	T551A	probably damaging	Het
Olfr267	T	C	4: 58,784,948	Y258C	probably damaging	Het
Olfr726	T	A	14: 50,084,525	D52V	probably damaging	Het
Pcm1	T	C	8: 41,293,793	L1343P	probably benign	Het
Pdcd1	T	A	1: 94,040,121	R202*	probably null	Het
Prkab2	A	G	3: 97,663,991		probably null	Het
Ptdss2	T	C	7: 141,154,949		probably benign	Het
Rap1b	G	T	10: 117,820,552	F78L	probably damaging	Het
Rbl2	C	T	8: 91,106,730	T711I	probably damaging	Het
Rhobtb2	A	G	14: 69,798,244	I126T	probably damaging	Het
Rnf123	A	C	9: 108,069,958	S210A	possibly damaging	Het
Shank1	T	A	7: 44,352,566	F1228L	probably benign	Het
Sumo1	C	A	1: 59,644,570	V38L	probably benign	Het
Sycp2	C	T	2: 178,383,560	S363N	probably damaging	Het
Tbx2	G	T	11: 85,837,846	E352*	probably null	Het
Timm44	T	C	8: 4,266,824	N270D	probably damaging	Het
Topaz1	A	T	9: 122,748,826	Q267L	probably benign	Het
Trp63	T	C	16: 25,876,733		probably benign	Het
Ushbp1	T	A	8: 71,391,003	T264S	possibly damaging	Het
Vav3	A	G	3: 109,516,067	Y334C	probably damaging	Het
Wdr36	G	C	18: 32,852,901	A553P	probably benign	Het
Zfhx2	A	T	14: 55,063,160	I2378K	probably damaging	Het
Zfp276	T	A	8: 123,255,933	Y145*	probably null	Het
Zfp458	T	C	13: 67,257,637	E246G	probably damaging	Het
Zfp526	A	G	7: 25,226,136	T607A	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCAGTGACTCATTCCACTGC -3'
(R):5'- TAGAAACACCGTGAAATCGTTC -3'

Sequencing Primer
(F):5'- ACTGCCCTGTGTCACAGC -3'
(R):5'- TGAGTTCCAGATCAGTCAGGACTC -3'

Posted On

2018-02-27