Incidental Mutation 'R6186:Cog2'
ID502180
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124546686 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 588 (T588N)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect probably damaging
Transcript: ENSMUST00000034460
AA Change: T588N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: T588N

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCAGTGACTCATTCCACTGC -3'
(R):5'- TAGAAACACCGTGAAATCGTTC -3'

Sequencing Primer
(F):5'- ACTGCCCTGTGTCACAGC -3'
(R):5'- TGAGTTCCAGATCAGTCAGGACTC -3'
Posted On2018-02-27