Mutagenetix > Incidental Mutation

Incidental Mutation 'R6186:Rnf123'

502183

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

044326-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R6186 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 108069958 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 210 (S210A)

Ref Sequence

ENSEMBL: ENSMUSP00000125495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably benign
Transcript: ENSMUST00000047746
AA Change: S210A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: S210A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000160249
AA Change: S210A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: S210A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160649
AA Change: S210A

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: S210A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

probably benign
Transcript: ENSMUST00000161828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162152

Predicted Effect

probably benign
Transcript: ENSMUST00000162355
AA Change: S210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: S210A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162516

Predicted Effect

probably benign
Transcript: ENSMUST00000174504

Predicted Effect

probably benign
Transcript: ENSMUST00000178267
AA Change: S210A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: S210A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	T	A	5: 94,383,976	Y240N	probably benign	Het
Adgb	A	G	10: 10,422,758	S409P	probably damaging	Het
Adgrg5	T	C	8: 94,934,024	V93A	possibly damaging	Het
Akap8l	C	T	17: 32,333,044	V420I	probably benign	Het
Ankrd36	T	G	11: 5,643,812	D472E	possibly damaging	Het
Apbb1	T	C	7: 105,567,726	E250G	probably damaging	Het
AW549877	C	A	15: 3,986,369	D238Y	possibly damaging	Het
Cacna2d4	G	A	6: 119,281,689	E579K	possibly damaging	Het
Capn7	G	T	14: 31,370,918	G780W	probably damaging	Het
Celsr1	T	C	15: 85,921,193	E2419G	possibly damaging	Het
Cep164	A	T	9: 45,794,109	S363R	probably damaging	Het
Cfap221	T	A	1: 119,934,610	I581F	probably damaging	Het
Cog2	C	A	8: 124,546,686	T588N	probably damaging	Het
Cyp2a5	T	C	7: 26,843,388		probably benign	Het
Cyp2j6	G	C	4: 96,536,086	L145V	probably damaging	Het
Evx1	T	C	6: 52,314,218		probably null	Het
Fam186a	T	C	15: 99,947,325	H346R	unknown	Het
Fam205c	T	C	4: 42,872,000	K125R	possibly damaging	Het
Fam53b	T	A	7: 132,715,716	D399V	possibly damaging	Het
Fcho2	T	A	13: 98,815,083	N9I	probably benign	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fkbpl	T	C	17: 34,646,179	F307S	probably benign	Het
Fn1	A	G	1: 71,637,290	I594T	probably damaging	Het
Inpp4b	T	A	8: 82,046,234	V719E	probably damaging	Het
Ldlr	C	T	9: 21,723,759		probably benign	Het
Macf1	A	G	4: 123,484,175	V1419A	probably damaging	Het
Mapkap1	A	G	2: 34,563,114	T340A	possibly damaging	Het
Mark2	A	G	19: 7,283,202	V403A	probably benign	Het
Mast3	T	C	8: 70,785,483	T521A	probably damaging	Het
Mkl1	T	C	15: 81,016,652	K546R	probably damaging	Het
Myo1h	C	T	5: 114,319,803	T125I	possibly damaging	Het
Ndufa8	A	G	2: 36,039,740	V118A	probably benign	Het
Nphs1	A	G	7: 30,465,634	T551A	probably damaging	Het
Olfr267	T	C	4: 58,784,948	Y258C	probably damaging	Het
Olfr726	T	A	14: 50,084,525	D52V	probably damaging	Het
Pcm1	T	C	8: 41,293,793	L1343P	probably benign	Het
Pdcd1	T	A	1: 94,040,121	R202*	probably null	Het
Prkab2	A	G	3: 97,663,991		probably null	Het
Ptdss2	T	C	7: 141,154,949		probably benign	Het
Rap1b	G	T	10: 117,820,552	F78L	probably damaging	Het
Rbl2	C	T	8: 91,106,730	T711I	probably damaging	Het
Rhobtb2	A	G	14: 69,798,244	I126T	probably damaging	Het
Shank1	T	A	7: 44,352,566	F1228L	probably benign	Het
Sumo1	C	A	1: 59,644,570	V38L	probably benign	Het
Sycp2	C	T	2: 178,383,560	S363N	probably damaging	Het
Tbx2	G	T	11: 85,837,846	E352*	probably null	Het
Timm44	T	C	8: 4,266,824	N270D	probably damaging	Het
Topaz1	A	T	9: 122,748,826	Q267L	probably benign	Het
Trp63	T	C	16: 25,876,733		probably benign	Het
Ushbp1	T	A	8: 71,391,003	T264S	possibly damaging	Het
Vav3	A	G	3: 109,516,067	Y334C	probably damaging	Het
Wdr36	G	C	18: 32,852,901	A553P	probably benign	Het
Zfhx2	A	T	14: 55,063,160	I2378K	probably damaging	Het
Zfp276	T	A	8: 123,255,933	Y145*	probably null	Het
Zfp458	T	C	13: 67,257,637	E246G	probably damaging	Het
Zfp526	A	G	7: 25,226,136	T607A	probably benign	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCTAGGCCCCTGGAAAG -3'
(R):5'- TTTTAGGTACCAGGGAAGAGCC -3'

Sequencing Primer
(F):5'- CCCTGGAAAGGTTCTCGAAG -3'
(R):5'- CAAGAGGTTTGGAGACTCCGAGTC -3'

Posted On

2018-02-27