Incidental Mutation 'R6186:Zfp458'
ID502189
Institutional Source Beutler Lab
Gene Symbol Zfp458
Ensembl Gene ENSMUSG00000055480
Gene Namezinc finger protein 458
SynonymsRslcan-7
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67254918-67278466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67257637 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 246 (E246G)
Ref Sequence ENSEMBL: ENSMUSP00000047222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045969] [ENSMUST00000223990] [ENSMUST00000225772]
Predicted Effect probably damaging
Transcript: ENSMUST00000045969
AA Change: E246G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047222
Gene: ENSMUSG00000055480
AA Change: E246G

DomainStartEndE-ValueType
KRAB 5 65 5.27e-32 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 1.03e-2 SMART
ZnF_C2H2 137 159 4.11e-2 SMART
ZnF_C2H2 193 215 2.17e1 SMART
ZnF_C2H2 221 243 2.95e-3 SMART
ZnF_C2H2 249 271 7.9e-4 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.63e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 3.52e-1 SMART
ZnF_C2H2 445 467 4.87e-4 SMART
ZnF_C2H2 473 495 7.26e-3 SMART
ZnF_C2H2 501 523 1.18e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.05e-2 SMART
ZnF_C2H2 585 607 7.78e-3 SMART
ZnF_C2H2 641 663 1.76e-1 SMART
ZnF_C2H2 669 691 5.21e-4 SMART
ZnF_C2H2 697 719 5.14e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223990
Predicted Effect possibly damaging
Transcript: ENSMUST00000225772
AA Change: E243G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Zfp458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Zfp458 APN 13 67257236 missense probably benign 0.01
IGL01989:Zfp458 APN 13 67259627 missense probably damaging 0.98
IGL02168:Zfp458 APN 13 67258034 missense probably damaging 0.98
IGL02620:Zfp458 APN 13 67257994 missense probably damaging 1.00
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0025:Zfp458 UTSW 13 67257898 missense probably damaging 0.98
R0066:Zfp458 UTSW 13 67259609 nonsense probably null
R0257:Zfp458 UTSW 13 67259642 nonsense probably null
R1218:Zfp458 UTSW 13 67256209 missense probably damaging 0.99
R1292:Zfp458 UTSW 13 67256690 missense probably damaging 1.00
R1490:Zfp458 UTSW 13 67257509 missense probably damaging 1.00
R1664:Zfp458 UTSW 13 67258080 missense possibly damaging 0.95
R2169:Zfp458 UTSW 13 67257049 missense probably damaging 1.00
R3769:Zfp458 UTSW 13 67257482 missense probably damaging 1.00
R5305:Zfp458 UTSW 13 67256318 missense probably benign 0.31
R5364:Zfp458 UTSW 13 67257948 nonsense probably null
R5426:Zfp458 UTSW 13 67257192 nonsense probably null
R5760:Zfp458 UTSW 13 67257789 missense probably damaging 1.00
R6151:Zfp458 UTSW 13 67257598 missense possibly damaging 0.95
R6298:Zfp458 UTSW 13 67256806 missense probably damaging 1.00
R7368:Zfp458 UTSW 13 67257236 missense probably benign 0.01
R7483:Zfp458 UTSW 13 67256914 missense possibly damaging 0.94
R7711:Zfp458 UTSW 13 67259600 missense possibly damaging 0.95
R7921:Zfp458 UTSW 13 67256116 makesense probably null
R7993:Zfp458 UTSW 13 67257170 missense probably damaging 1.00
R8240:Zfp458 UTSW 13 67258126 missense probably damaging 1.00
R8429:Zfp458 UTSW 13 67258088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CACACTTGCAGAGATTCTCTTTTG -3'
(R):5'- ATGGCAAGACCTTACATTGTCC -3'

Sequencing Primer
(F):5'- aatggaaggtcttgccac -3'
(R):5'- GTCCATCATTACTTTCTCAACACAAG -3'
Posted On2018-02-27