Incidental Mutation 'R6186:Capn7'
ID502191
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Namecalpain 7
SynonymsPalBH
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31336638-31371986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31370918 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 780 (G780W)
Ref Sequence ENSEMBL: ENSMUSP00000022451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002] [ENSMUST00000143472] [ENSMUST00000152182]
Predicted Effect probably damaging
Transcript: ENSMUST00000022451
AA Change: G780W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: G780W

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091903
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143472
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152182
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228237
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31363578 missense probably benign 0.41
IGL01481:Capn7 APN 14 31355339 missense probably damaging 1.00
IGL03231:Capn7 APN 14 31355290 missense probably damaging 1.00
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0077:Capn7 UTSW 14 31368115 missense probably benign 0.10
R0195:Capn7 UTSW 14 31365581 missense probably damaging 1.00
R0316:Capn7 UTSW 14 31347809 missense probably benign 0.00
R0815:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31360160 missense probably damaging 1.00
R1954:Capn7 UTSW 14 31360150 missense probably damaging 1.00
R2096:Capn7 UTSW 14 31349887 critical splice donor site probably null
R3121:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R3122:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R4409:Capn7 UTSW 14 31355339 missense probably damaging 1.00
R4676:Capn7 UTSW 14 31359259 missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31360557 missense probably benign 0.01
R5023:Capn7 UTSW 14 31352426 missense probably damaging 0.99
R5129:Capn7 UTSW 14 31344511 missense probably damaging 0.99
R5460:Capn7 UTSW 14 31368203 critical splice donor site probably null
R5608:Capn7 UTSW 14 31370707 missense probably damaging 1.00
R5665:Capn7 UTSW 14 31369802 missense probably benign 0.00
R5786:Capn7 UTSW 14 31360145 missense probably damaging 1.00
R6190:Capn7 UTSW 14 31363603 missense probably benign 0.10
R6411:Capn7 UTSW 14 31340096 missense probably benign 0.00
R6514:Capn7 UTSW 14 31344554 missense probably benign 0.00
R6838:Capn7 UTSW 14 31354173 missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31336685 unclassified probably benign
R7047:Capn7 UTSW 14 31336685 unclassified probably benign
R7124:Capn7 UTSW 14 31336685 unclassified probably benign
R7224:Capn7 UTSW 14 31370721 nonsense probably null
R7417:Capn7 UTSW 14 31370706 missense probably damaging 1.00
R7419:Capn7 UTSW 14 31349822 missense probably benign 0.02
R7544:Capn7 UTSW 14 31340050 missense probably damaging 1.00
R7699:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7700:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7775:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7824:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7908:Capn7 UTSW 14 31366245 critical splice donor site probably null
R8057:Capn7 UTSW 14 31370979 missense probably benign 0.27
R8176:Capn7 UTSW 14 31347772 missense probably benign 0.03
R8270:Capn7 UTSW 14 31358679 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAATGGGAGATCCTGGTCCTC -3'
(R):5'- CAGACTCCGTAACATGCTTTTG -3'

Sequencing Primer
(F):5'- GTCCTCATGGCTTTCAGAGGAAATC -3'
(R):5'- CCGTAACATGCTTTTGATTTAATTCC -3'
Posted On2018-02-27