Incidental Mutation 'R6186:Capn7'
ID 502191
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Name calpain 7
Synonyms PalBH
MMRRC Submission 044326-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.818) question?
Stock # R6186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 31058595-31093943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 31092875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 780 (G780W)
Ref Sequence ENSEMBL: ENSMUSP00000022451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002] [ENSMUST00000143472] [ENSMUST00000152182]
AlphaFold Q9R1S8
Predicted Effect probably damaging
Transcript: ENSMUST00000022451
AA Change: G780W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: G780W

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091903
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143472
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152182
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228237
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,298,502 (GRCm39) S409P probably damaging Het
Adgrg5 T C 8: 95,660,652 (GRCm39) V93A possibly damaging Het
Akap8l C T 17: 32,552,018 (GRCm39) V420I probably benign Het
Ankrd36 T G 11: 5,593,812 (GRCm39) D472E possibly damaging Het
Apbb1 T C 7: 105,216,933 (GRCm39) E250G probably damaging Het
Cacna2d4 G A 6: 119,258,650 (GRCm39) E579K possibly damaging Het
Celsr1 T C 15: 85,805,394 (GRCm39) E2419G possibly damaging Het
Cep164 A T 9: 45,705,407 (GRCm39) S363R probably damaging Het
Cfap221 T A 1: 119,862,340 (GRCm39) I581F probably damaging Het
Cog2 C A 8: 125,273,425 (GRCm39) T588N probably damaging Het
Cyp2a5 T C 7: 26,542,813 (GRCm39) probably benign Het
Cyp2j6 G C 4: 96,424,323 (GRCm39) L145V probably damaging Het
Evx1 T C 6: 52,291,203 (GRCm39) probably null Het
Fam186a T C 15: 99,845,206 (GRCm39) H346R unknown Het
Fam53b T A 7: 132,317,445 (GRCm39) D399V possibly damaging Het
Fcho2 T A 13: 98,951,591 (GRCm39) N9I probably benign Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fkbpl T C 17: 34,865,153 (GRCm39) F307S probably benign Het
Fn1 A G 1: 71,676,449 (GRCm39) I594T probably damaging Het
Inpp4b T A 8: 82,772,863 (GRCm39) V719E probably damaging Het
Ldlr C T 9: 21,635,055 (GRCm39) probably benign Het
Macf1 A G 4: 123,377,968 (GRCm39) V1419A probably damaging Het
Mapkap1 A G 2: 34,453,126 (GRCm39) T340A possibly damaging Het
Mark2 A G 19: 7,260,567 (GRCm39) V403A probably benign Het
Mast3 T C 8: 71,238,127 (GRCm39) T521A probably damaging Het
Mrtfa T C 15: 80,900,853 (GRCm39) K546R probably damaging Het
Myo1h C T 5: 114,457,864 (GRCm39) T125I possibly damaging Het
Ndufa8 A G 2: 35,929,752 (GRCm39) V118A probably benign Het
Nphs1 A G 7: 30,165,059 (GRCm39) T551A probably damaging Het
Or2k2 T C 4: 58,784,948 (GRCm39) Y258C probably damaging Het
Or4k15c T A 14: 50,321,982 (GRCm39) D52V probably damaging Het
Pcm1 T C 8: 41,746,830 (GRCm39) L1343P probably benign Het
Pdcd1 T A 1: 93,967,846 (GRCm39) R202* probably null Het
Pramel52-ps T A 5: 94,531,835 (GRCm39) Y240N probably benign Het
Prkab2 A G 3: 97,571,307 (GRCm39) probably null Het
Ptdss2 T C 7: 140,734,862 (GRCm39) probably benign Het
Rap1b G T 10: 117,656,457 (GRCm39) F78L probably damaging Het
Rbl2 C T 8: 91,833,358 (GRCm39) T711I probably damaging Het
Rhobtb2 A G 14: 70,035,693 (GRCm39) I126T probably damaging Het
Rimoc1 C A 15: 4,015,851 (GRCm39) D238Y possibly damaging Het
Rnf123 A C 9: 107,947,157 (GRCm39) S210A possibly damaging Het
Shank1 T A 7: 44,001,990 (GRCm39) F1228L probably benign Het
Spata31f3 T C 4: 42,872,000 (GRCm39) K125R possibly damaging Het
Sumo1 C A 1: 59,683,729 (GRCm39) V38L probably benign Het
Sycp2 C T 2: 178,025,353 (GRCm39) S363N probably damaging Het
Tbx2 G T 11: 85,728,672 (GRCm39) E352* probably null Het
Timm44 T C 8: 4,316,824 (GRCm39) N270D probably damaging Het
Topaz1 A T 9: 122,577,891 (GRCm39) Q267L probably benign Het
Trp63 T C 16: 25,695,483 (GRCm39) probably benign Het
Ushbp1 T A 8: 71,843,647 (GRCm39) T264S possibly damaging Het
Vav3 A G 3: 109,423,383 (GRCm39) Y334C probably damaging Het
Wdr36 G C 18: 32,985,954 (GRCm39) A553P probably benign Het
Zfhx2 A T 14: 55,300,617 (GRCm39) I2378K probably damaging Het
Zfp276 T A 8: 123,982,672 (GRCm39) Y145* probably null Het
Zfp458 T C 13: 67,405,701 (GRCm39) E246G probably damaging Het
Zfp526 A G 7: 24,925,561 (GRCm39) T607A probably benign Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31,085,535 (GRCm39) missense probably benign 0.41
IGL01481:Capn7 APN 14 31,077,296 (GRCm39) missense probably damaging 1.00
IGL03231:Capn7 APN 14 31,077,247 (GRCm39) missense probably damaging 1.00
R0018:Capn7 UTSW 14 31,076,069 (GRCm39) nonsense probably null
R0018:Capn7 UTSW 14 31,076,069 (GRCm39) nonsense probably null
R0060:Capn7 UTSW 14 31,087,561 (GRCm39) splice site probably benign
R0060:Capn7 UTSW 14 31,087,561 (GRCm39) splice site probably benign
R0077:Capn7 UTSW 14 31,090,072 (GRCm39) missense probably benign 0.10
R0195:Capn7 UTSW 14 31,087,538 (GRCm39) missense probably damaging 1.00
R0316:Capn7 UTSW 14 31,069,766 (GRCm39) missense probably benign 0.00
R0815:Capn7 UTSW 14 31,091,714 (GRCm39) missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31,091,714 (GRCm39) missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31,082,117 (GRCm39) missense probably damaging 1.00
R1954:Capn7 UTSW 14 31,082,107 (GRCm39) missense probably damaging 1.00
R2096:Capn7 UTSW 14 31,071,844 (GRCm39) critical splice donor site probably null
R3121:Capn7 UTSW 14 31,081,167 (GRCm39) missense probably damaging 1.00
R3122:Capn7 UTSW 14 31,081,167 (GRCm39) missense probably damaging 1.00
R4409:Capn7 UTSW 14 31,077,296 (GRCm39) missense probably damaging 1.00
R4676:Capn7 UTSW 14 31,081,216 (GRCm39) missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31,082,514 (GRCm39) missense probably benign 0.01
R5023:Capn7 UTSW 14 31,074,383 (GRCm39) missense probably damaging 0.99
R5129:Capn7 UTSW 14 31,066,468 (GRCm39) missense probably damaging 0.99
R5460:Capn7 UTSW 14 31,090,160 (GRCm39) critical splice donor site probably null
R5608:Capn7 UTSW 14 31,092,664 (GRCm39) missense probably damaging 1.00
R5665:Capn7 UTSW 14 31,091,759 (GRCm39) missense probably benign 0.00
R5786:Capn7 UTSW 14 31,082,102 (GRCm39) missense probably damaging 1.00
R6190:Capn7 UTSW 14 31,085,560 (GRCm39) missense probably benign 0.10
R6411:Capn7 UTSW 14 31,062,053 (GRCm39) missense probably benign 0.00
R6514:Capn7 UTSW 14 31,066,511 (GRCm39) missense probably benign 0.00
R6838:Capn7 UTSW 14 31,076,130 (GRCm39) missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31,058,642 (GRCm39) unclassified probably benign
R7047:Capn7 UTSW 14 31,058,642 (GRCm39) unclassified probably benign
R7124:Capn7 UTSW 14 31,058,642 (GRCm39) unclassified probably benign
R7224:Capn7 UTSW 14 31,092,678 (GRCm39) nonsense probably null
R7417:Capn7 UTSW 14 31,092,663 (GRCm39) missense probably damaging 1.00
R7419:Capn7 UTSW 14 31,071,779 (GRCm39) missense probably benign 0.02
R7544:Capn7 UTSW 14 31,062,007 (GRCm39) missense probably damaging 1.00
R7699:Capn7 UTSW 14 31,074,401 (GRCm39) missense probably benign 0.00
R7700:Capn7 UTSW 14 31,074,401 (GRCm39) missense probably benign 0.00
R7775:Capn7 UTSW 14 31,074,367 (GRCm39) missense probably benign 0.00
R7824:Capn7 UTSW 14 31,074,367 (GRCm39) missense probably benign 0.00
R7908:Capn7 UTSW 14 31,088,202 (GRCm39) critical splice donor site probably null
R8057:Capn7 UTSW 14 31,092,936 (GRCm39) missense probably benign 0.27
R8176:Capn7 UTSW 14 31,069,729 (GRCm39) missense probably benign 0.03
R8270:Capn7 UTSW 14 31,080,636 (GRCm39) missense probably damaging 0.97
R9103:Capn7 UTSW 14 31,091,732 (GRCm39) missense probably benign 0.23
R9732:Capn7 UTSW 14 31,090,031 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATGGGAGATCCTGGTCCTC -3'
(R):5'- CAGACTCCGTAACATGCTTTTG -3'

Sequencing Primer
(F):5'- GTCCTCATGGCTTTCAGAGGAAATC -3'
(R):5'- CCGTAACATGCTTTTGATTTAATTCC -3'
Posted On 2018-02-27