Mutagenetix > Incidental Mutation

Incidental Mutation 'R6186:Celsr1'

502197

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

Scy, Adgrc1, Crsh, crash

MMRRC Submission

044326-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.634) question?

Stock #

R6186 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85783130-85918404 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85805394 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2419 (E2419G)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000016172
AA Change: E2419G

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: E2419G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000226840
AA Change: E1052G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227450

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,298,502 (GRCm39)	S409P	probably damaging	Het
Adgrg5	T	C	8: 95,660,652 (GRCm39)	V93A	possibly damaging	Het
Akap8l	C	T	17: 32,552,018 (GRCm39)	V420I	probably benign	Het
Ankrd36	T	G	11: 5,593,812 (GRCm39)	D472E	possibly damaging	Het
Apbb1	T	C	7: 105,216,933 (GRCm39)	E250G	probably damaging	Het
Cacna2d4	G	A	6: 119,258,650 (GRCm39)	E579K	possibly damaging	Het
Capn7	G	T	14: 31,092,875 (GRCm39)	G780W	probably damaging	Het
Cep164	A	T	9: 45,705,407 (GRCm39)	S363R	probably damaging	Het
Cfap221	T	A	1: 119,862,340 (GRCm39)	I581F	probably damaging	Het
Cog2	C	A	8: 125,273,425 (GRCm39)	T588N	probably damaging	Het
Cyp2a5	T	C	7: 26,542,813 (GRCm39)		probably benign	Het
Cyp2j6	G	C	4: 96,424,323 (GRCm39)	L145V	probably damaging	Het
Evx1	T	C	6: 52,291,203 (GRCm39)		probably null	Het
Fam186a	T	C	15: 99,845,206 (GRCm39)	H346R	unknown	Het
Fam53b	T	A	7: 132,317,445 (GRCm39)	D399V	possibly damaging	Het
Fcho2	T	A	13: 98,951,591 (GRCm39)	N9I	probably benign	Het
Fjx1	T	C	2: 102,281,152 (GRCm39)	E261G	probably benign	Het
Fkbpl	G	A	17: 34,864,303 (GRCm39)	A24T	probably benign	Het
Fkbpl	T	C	17: 34,865,153 (GRCm39)	F307S	probably benign	Het
Fn1	A	G	1: 71,676,449 (GRCm39)	I594T	probably damaging	Het
Inpp4b	T	A	8: 82,772,863 (GRCm39)	V719E	probably damaging	Het
Ldlr	C	T	9: 21,635,055 (GRCm39)		probably benign	Het
Macf1	A	G	4: 123,377,968 (GRCm39)	V1419A	probably damaging	Het
Mapkap1	A	G	2: 34,453,126 (GRCm39)	T340A	possibly damaging	Het
Mark2	A	G	19: 7,260,567 (GRCm39)	V403A	probably benign	Het
Mast3	T	C	8: 71,238,127 (GRCm39)	T521A	probably damaging	Het
Mrtfa	T	C	15: 80,900,853 (GRCm39)	K546R	probably damaging	Het
Myo1h	C	T	5: 114,457,864 (GRCm39)	T125I	possibly damaging	Het
Ndufa8	A	G	2: 35,929,752 (GRCm39)	V118A	probably benign	Het
Nphs1	A	G	7: 30,165,059 (GRCm39)	T551A	probably damaging	Het
Or2k2	T	C	4: 58,784,948 (GRCm39)	Y258C	probably damaging	Het
Or4k15c	T	A	14: 50,321,982 (GRCm39)	D52V	probably damaging	Het
Pcm1	T	C	8: 41,746,830 (GRCm39)	L1343P	probably benign	Het
Pdcd1	T	A	1: 93,967,846 (GRCm39)	R202*	probably null	Het
Pramel52-ps	T	A	5: 94,531,835 (GRCm39)	Y240N	probably benign	Het
Prkab2	A	G	3: 97,571,307 (GRCm39)		probably null	Het
Ptdss2	T	C	7: 140,734,862 (GRCm39)		probably benign	Het
Rap1b	G	T	10: 117,656,457 (GRCm39)	F78L	probably damaging	Het
Rbl2	C	T	8: 91,833,358 (GRCm39)	T711I	probably damaging	Het
Rhobtb2	A	G	14: 70,035,693 (GRCm39)	I126T	probably damaging	Het
Rimoc1	C	A	15: 4,015,851 (GRCm39)	D238Y	possibly damaging	Het
Rnf123	A	C	9: 107,947,157 (GRCm39)	S210A	possibly damaging	Het
Shank1	T	A	7: 44,001,990 (GRCm39)	F1228L	probably benign	Het
Spata31f3	T	C	4: 42,872,000 (GRCm39)	K125R	possibly damaging	Het
Sumo1	C	A	1: 59,683,729 (GRCm39)	V38L	probably benign	Het
Sycp2	C	T	2: 178,025,353 (GRCm39)	S363N	probably damaging	Het
Tbx2	G	T	11: 85,728,672 (GRCm39)	E352*	probably null	Het
Timm44	T	C	8: 4,316,824 (GRCm39)	N270D	probably damaging	Het
Topaz1	A	T	9: 122,577,891 (GRCm39)	Q267L	probably benign	Het
Trp63	T	C	16: 25,695,483 (GRCm39)		probably benign	Het
Ushbp1	T	A	8: 71,843,647 (GRCm39)	T264S	possibly damaging	Het
Vav3	A	G	3: 109,423,383 (GRCm39)	Y334C	probably damaging	Het
Wdr36	G	C	18: 32,985,954 (GRCm39)	A553P	probably benign	Het
Zfhx2	A	T	14: 55,300,617 (GRCm39)	I2378K	probably damaging	Het
Zfp276	T	A	8: 123,982,672 (GRCm39)	Y145*	probably null	Het
Zfp458	T	C	13: 67,405,701 (GRCm39)	E246G	probably damaging	Het
Zfp526	A	G	7: 24,925,561 (GRCm39)	T607A	probably benign	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85,815,546 (GRCm39)	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	85,915,037 (GRCm39)	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85,806,436 (GRCm39)	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	85,914,692 (GRCm39)	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85,810,391 (GRCm39)	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85,814,096 (GRCm39)	missense	probably benign
IGL01931:Celsr1	APN	15	85,791,861 (GRCm39)	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85,847,424 (GRCm39)	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85,791,922 (GRCm39)	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85,863,205 (GRCm39)	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85,814,108 (GRCm39)	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	85,915,427 (GRCm39)	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85,825,337 (GRCm39)	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85,784,889 (GRCm39)	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	85,914,818 (GRCm39)	nonsense	probably null
IGL02899:Celsr1	APN	15	85,915,927 (GRCm39)	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85,785,673 (GRCm39)	missense	probably benign
IGL03212:Celsr1	APN	15	85,814,878 (GRCm39)	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85,806,436 (GRCm39)	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85,785,138 (GRCm39)	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	85,916,615 (GRCm39)	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	85,915,243 (GRCm39)	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	85,915,243 (GRCm39)	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85,813,620 (GRCm39)	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	85,914,963 (GRCm39)	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85,806,399 (GRCm39)	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85,806,399 (GRCm39)	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85,787,065 (GRCm39)	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85,787,566 (GRCm39)	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85,816,524 (GRCm39)	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85,785,798 (GRCm39)	missense	probably benign
R0792:Celsr1	UTSW	15	85,815,477 (GRCm39)	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85,787,489 (GRCm39)	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	85,915,480 (GRCm39)	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	85,916,248 (GRCm39)	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85,788,175 (GRCm39)	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85,863,347 (GRCm39)	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85,789,635 (GRCm39)	splice site	probably null
R1405:Celsr1	UTSW	15	85,789,635 (GRCm39)	splice site	probably null
R1522:Celsr1	UTSW	15	85,815,477 (GRCm39)	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	85,915,263 (GRCm39)	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85,816,658 (GRCm39)	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	85,914,524 (GRCm39)	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	85,916,886 (GRCm39)	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	85,916,960 (GRCm39)	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	85,917,088 (GRCm39)	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	85,914,748 (GRCm39)	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85,847,424 (GRCm39)	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	85,916,168 (GRCm39)	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85,863,431 (GRCm39)	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85,800,924 (GRCm39)	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	85,916,008 (GRCm39)	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85,863,028 (GRCm39)	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85,812,200 (GRCm39)	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85,847,334 (GRCm39)	missense	probably benign	0.00
R4416:Celsr1	UTSW	15	85,812,200 (GRCm39)	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85,800,957 (GRCm39)	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	85,914,695 (GRCm39)	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85,816,661 (GRCm39)	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85,790,230 (GRCm39)	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85,822,154 (GRCm39)	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85,822,112 (GRCm39)	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85,823,335 (GRCm39)	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85,816,585 (GRCm39)	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85,814,747 (GRCm39)	missense	probably benign
R5310:Celsr1	UTSW	15	85,810,423 (GRCm39)	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85,809,719 (GRCm39)	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85,815,483 (GRCm39)	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	85,914,968 (GRCm39)	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85,825,465 (GRCm39)	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	85,917,156 (GRCm39)	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85,788,215 (GRCm39)	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85,914,550 (GRCm39)	missense	probably damaging	0.96
R5915:Celsr1	UTSW	15	85,822,176 (GRCm39)	missense	probably benign
R5932:Celsr1	UTSW	15	85,916,905 (GRCm39)	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	85,916,701 (GRCm39)	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85,803,239 (GRCm39)	splice site	probably null
R6050:Celsr1	UTSW	15	85,814,812 (GRCm39)	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85,816,612 (GRCm39)	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85,785,222 (GRCm39)	missense	probably benign	0.08
R6212:Celsr1	UTSW	15	85,800,888 (GRCm39)	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85,812,531 (GRCm39)	missense	probably benign
R6320:Celsr1	UTSW	15	85,785,160 (GRCm39)	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	85,915,885 (GRCm39)	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85,809,719 (GRCm39)	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85,863,121 (GRCm39)	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85,847,486 (GRCm39)	missense	probably benign
R6615:Celsr1	UTSW	15	85,786,315 (GRCm39)	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85,803,135 (GRCm39)	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85,790,115 (GRCm39)	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85,791,799 (GRCm39)	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	85,915,696 (GRCm39)	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	85,914,983 (GRCm39)	missense	probably benign
R6838:Celsr1	UTSW	15	85,823,395 (GRCm39)	missense	probably benign
R6886:Celsr1	UTSW	15	85,915,855 (GRCm39)	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85,789,679 (GRCm39)	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	85,916,856 (GRCm39)	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85,816,652 (GRCm39)	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	85,917,209 (GRCm39)	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	85,914,715 (GRCm39)	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	85,914,875 (GRCm39)	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85,791,874 (GRCm39)	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	85,917,593 (GRCm39)	missense	probably benign
R7491:Celsr1	UTSW	15	85,916,719 (GRCm39)	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85,814,073 (GRCm39)	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85,862,933 (GRCm39)	nonsense	probably null
R7741:Celsr1	UTSW	15	85,863,303 (GRCm39)	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85,816,610 (GRCm39)	missense	probably benign
R7974:Celsr1	UTSW	15	85,915,231 (GRCm39)	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	85,917,194 (GRCm39)	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	85,917,194 (GRCm39)	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85,823,356 (GRCm39)	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	85,915,801 (GRCm39)	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85,787,090 (GRCm39)	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85,863,436 (GRCm39)	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8290:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8292:Celsr1	UTSW	15	85,791,819 (GRCm39)	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85,806,445 (GRCm39)	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85,816,501 (GRCm39)	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	85,915,615 (GRCm39)	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8384:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8452:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8463:Celsr1	UTSW	15	85,914,415 (GRCm39)	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8480:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8493:Celsr1	UTSW	15	85,822,207 (GRCm39)	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85,823,306 (GRCm39)	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8771:Celsr1	UTSW	15	85,788,175 (GRCm39)	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85,822,194 (GRCm39)	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85,788,269 (GRCm39)	intron	probably benign
R8924:Celsr1	UTSW	15	85,916,671 (GRCm39)	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85,847,340 (GRCm39)	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	85,914,772 (GRCm39)	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85,803,217 (GRCm39)	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9196:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9198:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9200:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9201:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9202:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9203:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9222:Celsr1	UTSW	15	85,815,471 (GRCm39)	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	85,915,051 (GRCm39)	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9386:Celsr1	UTSW	15	85,863,231 (GRCm39)	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9401:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9415:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9428:Celsr1	UTSW	15	85,815,549 (GRCm39)	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85,806,535 (GRCm39)	splice site	probably benign
R9493:Celsr1	UTSW	15	85,785,346 (GRCm39)	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9499:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9607:Celsr1	UTSW	15	85,915,229 (GRCm39)	missense
R9673:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
Z1176:Celsr1	UTSW	15	85,847,301 (GRCm39)	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85,863,052 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACCTCCCGTCTTGCTAAG -3'
(R):5'- CATAGTGTCTGGACTCAGGC -3'

Sequencing Primer
(F):5'- CCGTCTTGCTAAGCCTGGAAATG -3'
(R):5'- TGTCTGGACTCAGGCTCTCG -3'

Posted On

2018-02-27