Incidental Mutation 'R6187:Hmcn1'
ID 502208
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms EG545370, LOC240793
MMRRC Submission 044327-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6187 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 150438275-150869186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150506479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3776 (D3776G)
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074783
AA Change: D3776G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: D3776G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137197
AA Change: D3776G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: D3776G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177268
Meta Mutation Damage Score 0.9041 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,259,085 (GRCm39) L2937H probably damaging Het
Abca3 A G 17: 24,627,141 (GRCm39) I1281V possibly damaging Het
Adam2 A T 14: 66,306,068 (GRCm39) S138T possibly damaging Het
Adamts4 C T 1: 171,078,562 (GRCm39) P61S probably damaging Het
Adamts6 C T 13: 104,433,933 (GRCm39) P121S probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ak1 G A 2: 32,523,489 (GRCm39) V186M probably damaging Het
Alpk1 T C 3: 127,466,991 (GRCm39) Y1096C probably damaging Het
Ankrd29 A C 18: 12,412,747 (GRCm39) Y73* probably null Het
Asah2 A T 19: 32,002,267 (GRCm39) S292R probably damaging Het
Atp6v1b1 A T 6: 83,729,377 (GRCm39) T105S probably damaging Het
Axdnd1 T A 1: 156,193,182 (GRCm39) probably null Het
Bub1b T G 2: 118,461,481 (GRCm39) S678A probably damaging Het
Cdcp3 G A 7: 130,872,328 (GRCm39) probably benign Het
Cenpq T A 17: 41,238,089 (GRCm39) M142L probably benign Het
Ciz1 T A 2: 32,260,063 (GRCm39) V203E possibly damaging Het
Cmklr2 T C 1: 63,222,434 (GRCm39) E267G probably damaging Het
Col2a1 G T 15: 97,886,671 (GRCm39) T378N unknown Het
Cyp2c68 A T 19: 39,729,452 (GRCm39) S12T probably benign Het
Cyp4f18 C A 8: 72,747,030 (GRCm39) A322S probably damaging Het
Disp2 A G 2: 118,622,624 (GRCm39) S1119G probably damaging Het
Eif2ak4 C T 2: 118,287,638 (GRCm39) T1081M probably damaging Het
Faxc A G 4: 21,958,445 (GRCm39) T201A possibly damaging Het
Fbxw14 A G 9: 109,105,332 (GRCm39) S278P probably damaging Het
Fpr1 G T 17: 18,097,190 (GRCm39) C266* probably null Het
Fsip2 T C 2: 82,812,798 (GRCm39) I3039T probably benign Het
Gas1 G T 13: 60,324,186 (GRCm39) S190R possibly damaging Het
Gemin2 A G 12: 59,060,371 (GRCm39) T37A probably damaging Het
Gm21370 T C 13: 120,488,403 (GRCm39) I49V probably benign Het
Gm8444 T C 15: 81,727,807 (GRCm39) probably benign Het
Gria1 A G 11: 57,128,936 (GRCm39) D401G possibly damaging Het
Gstk1 G A 6: 42,226,794 (GRCm39) V187I possibly damaging Het
Itfg1 A C 8: 86,563,094 (GRCm39) V102G probably damaging Het
Kidins220 A G 12: 25,101,307 (GRCm39) probably null Het
Kif13b A C 14: 64,973,664 (GRCm39) D338A probably damaging Het
Mab21l2 T C 3: 86,454,565 (GRCm39) Y145C probably damaging Het
Magel2 A G 7: 62,027,389 (GRCm39) M98V unknown Het
Mdfic T C 6: 15,721,196 (GRCm39) probably benign Het
Minar1 A G 9: 89,473,220 (GRCm39) I897T probably damaging Het
Mlip G A 9: 77,137,764 (GRCm39) S381L probably damaging Het
Mycbp2 A G 14: 103,384,453 (GRCm39) L3475P probably damaging Het
Myh14 G A 7: 44,276,457 (GRCm39) T1216I probably damaging Het
Nfatc2 T A 2: 168,322,158 (GRCm39) I914F probably benign Het
Nup58 T C 14: 60,478,256 (GRCm39) probably null Het
Or10ag53 T A 2: 87,083,042 (GRCm39) S254T probably damaging Het
Or10al4 T C 17: 38,037,032 (GRCm39) L48P probably damaging Het
Or13a22 A G 7: 140,072,529 (GRCm39) probably benign Het
Or2y13 G T 11: 49,414,338 (GRCm39) probably benign Het
Or4l15 A G 14: 50,198,526 (GRCm39) M1T probably null Het
Or5p50 A T 7: 107,421,781 (GRCm39) N298K probably benign Het
Or7g20 A C 9: 18,946,689 (GRCm39) Q90P probably benign Het
Otx1 A T 11: 21,949,406 (GRCm39) L24H probably damaging Het
Oxr1 A G 15: 41,689,315 (GRCm39) Q513R probably damaging Het
Padi1 C T 4: 140,554,276 (GRCm39) V310M probably damaging Het
Pard3 T C 8: 127,800,023 (GRCm39) L11S probably benign Het
Pcdhb14 A T 18: 37,581,497 (GRCm39) D201V probably damaging Het
Pcdhb7 A G 18: 37,475,622 (GRCm39) R253G probably benign Het
Plxnb2 C T 15: 89,051,461 (GRCm39) D253N probably damaging Het
Ppp2cb T C 8: 34,105,502 (GRCm39) S171P probably damaging Het
Prr5 C T 15: 84,577,973 (GRCm39) T94M probably damaging Het
Rp1 A G 1: 4,420,092 (GRCm39) F340S probably damaging Het
Rpa1 C G 11: 75,201,062 (GRCm39) G433A probably benign Het
Smg1 A T 7: 117,788,386 (GRCm39) probably benign Het
Sry C G Y: 2,662,975 (GRCm39) Q228H unknown Homo
Svep1 C T 4: 58,072,872 (GRCm39) G2146R probably damaging Het
Tas2r106 A G 6: 131,655,173 (GRCm39) M226T probably damaging Het
Tbk1 T C 10: 121,420,148 (GRCm39) I14V probably benign Het
Tekt4 G C 17: 25,691,197 (GRCm39) V168L probably damaging Het
Tnfaip1 T A 11: 78,418,372 (GRCm39) T232S probably damaging Het
Trio C T 15: 27,744,038 (GRCm39) probably null Het
Ttn T A 2: 76,774,781 (GRCm39) Y2133F unknown Het
Uap1l1 C T 2: 25,252,741 (GRCm39) R433H probably damaging Het
Ugt2b35 T C 5: 87,155,181 (GRCm39) F339L probably damaging Het
Unc5b T C 10: 60,608,003 (GRCm39) Y699C probably damaging Het
Vcpip1 T C 1: 9,795,005 (GRCm39) H1122R probably damaging Het
Vmn2r91 T C 17: 18,326,888 (GRCm39) V391A probably benign Het
Vps13c C T 9: 67,822,939 (GRCm39) R1327W probably damaging Het
Yes1 A G 5: 32,802,385 (GRCm39) Y100C probably damaging Het
Zfp407 A T 18: 84,577,134 (GRCm39) N1326K possibly damaging Het
Zfp518a G A 19: 40,903,890 (GRCm39) C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,317 (GRCm39) probably benign Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,553,029 (GRCm39) missense probably benign
IGL00571:Hmcn1 APN 1 150,514,750 (GRCm39) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,682,117 (GRCm39) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,540,687 (GRCm39) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,532,485 (GRCm39) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,506,091 (GRCm39) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,486,464 (GRCm39) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,480,757 (GRCm39) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,458,052 (GRCm39) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,514,620 (GRCm39) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,502,784 (GRCm39) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,508,303 (GRCm39) splice site probably benign
IGL01304:Hmcn1 APN 1 150,498,675 (GRCm39) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,620,752 (GRCm39) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,594,991 (GRCm39) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,468,848 (GRCm39) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,734,990 (GRCm39) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,480,823 (GRCm39) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,485,382 (GRCm39) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,474,148 (GRCm39) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,503,164 (GRCm39) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,547,783 (GRCm39) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,455,984 (GRCm39) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,613,050 (GRCm39) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,459,031 (GRCm39) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,620,711 (GRCm39) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,547,789 (GRCm39) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,491,051 (GRCm39) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,566,352 (GRCm39) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,618,011 (GRCm39) splice site probably benign
IGL01906:Hmcn1 APN 1 150,543,638 (GRCm39) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,608,643 (GRCm39) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,479,622 (GRCm39) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,491,049 (GRCm39) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,579,932 (GRCm39) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,506,479 (GRCm39) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,598,358 (GRCm39) missense probably benign
IGL02155:Hmcn1 APN 1 150,439,349 (GRCm39) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,682,152 (GRCm39) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,540,666 (GRCm39) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,678,648 (GRCm39) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,598,175 (GRCm39) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,868,774 (GRCm39) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,685,477 (GRCm39) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,573,244 (GRCm39) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,620,746 (GRCm39) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,494,760 (GRCm39) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,480,654 (GRCm39) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,532,445 (GRCm39) nonsense probably null
IGL02735:Hmcn1 APN 1 150,522,583 (GRCm39) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,439,579 (GRCm39) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,551,725 (GRCm39) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,453,029 (GRCm39) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,532,958 (GRCm39) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,573,273 (GRCm39) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,547,668 (GRCm39) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,684,290 (GRCm39) missense probably benign
IGL03195:Hmcn1 APN 1 150,678,660 (GRCm39) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,619,418 (GRCm39) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,646,103 (GRCm39) splice site probably benign
IGL03268:Hmcn1 APN 1 150,648,261 (GRCm39) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,474,175 (GRCm39) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,505,982 (GRCm39) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,608,661 (GRCm39) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,577,720 (GRCm39) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,539,623 (GRCm39) missense probably damaging 1.00
Backbone UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
Cambrian UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
chordate UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
Justamere UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
Lancelet UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
notochord UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
wippoorwill UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,614,409 (GRCm39) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,596,440 (GRCm39) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,684,488 (GRCm39) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,545,238 (GRCm39) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,684,427 (GRCm39) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,528,302 (GRCm39) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,553,157 (GRCm39) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,684,398 (GRCm39) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,553,075 (GRCm39) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,539,630 (GRCm39) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,479,562 (GRCm39) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,674,565 (GRCm39) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,591,573 (GRCm39) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,608,543 (GRCm39) splice site probably benign
R0503:Hmcn1 UTSW 1 150,735,003 (GRCm39) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,752,170 (GRCm39) splice site probably benign
R0506:Hmcn1 UTSW 1 150,618,092 (GRCm39) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,594,868 (GRCm39) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,525,768 (GRCm39) nonsense probably null
R0599:Hmcn1 UTSW 1 150,485,552 (GRCm39) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,533,127 (GRCm39) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,469,767 (GRCm39) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,674,470 (GRCm39) splice site probably null
R0699:Hmcn1 UTSW 1 150,695,161 (GRCm39) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,684,538 (GRCm39) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,629,416 (GRCm39) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,525,824 (GRCm39) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R0975:Hmcn1 UTSW 1 150,453,128 (GRCm39) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1233:Hmcn1 UTSW 1 150,624,777 (GRCm39) missense probably benign
R1234:Hmcn1 UTSW 1 150,629,405 (GRCm39) nonsense probably null
R1291:Hmcn1 UTSW 1 150,623,942 (GRCm39) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,556,466 (GRCm39) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,522,545 (GRCm39) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,528,257 (GRCm39) splice site probably benign
R1458:Hmcn1 UTSW 1 150,485,451 (GRCm39) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,648,303 (GRCm39) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,545,172 (GRCm39) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,649,554 (GRCm39) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,610,283 (GRCm39) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,532,992 (GRCm39) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,620,778 (GRCm39) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,545,309 (GRCm39) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,506,084 (GRCm39) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,441,120 (GRCm39) nonsense probably null
R1710:Hmcn1 UTSW 1 150,551,735 (GRCm39) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,734,937 (GRCm39) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,474,781 (GRCm39) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,439,319 (GRCm39) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,624,834 (GRCm39) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,502,903 (GRCm39) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,474,036 (GRCm39) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,597,415 (GRCm39) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,532,944 (GRCm39) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,479,563 (GRCm39) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,596,446 (GRCm39) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,453,046 (GRCm39) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,533,202 (GRCm39) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,868,606 (GRCm39) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,480,633 (GRCm39) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,525,427 (GRCm39) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,553,127 (GRCm39) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,551,742 (GRCm39) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,614,364 (GRCm39) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,553,085 (GRCm39) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,453,074 (GRCm39) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,509,410 (GRCm39) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,591,566 (GRCm39) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,474,761 (GRCm39) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,500,349 (GRCm39) splice site probably benign
R2303:Hmcn1 UTSW 1 150,579,977 (GRCm39) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,528,429 (GRCm39) splice site probably benign
R2338:Hmcn1 UTSW 1 150,498,685 (GRCm39) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,441,135 (GRCm39) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,736,092 (GRCm39) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,474,783 (GRCm39) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,490,972 (GRCm39) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,562,618 (GRCm39) nonsense probably null
R2519:Hmcn1 UTSW 1 150,649,571 (GRCm39) nonsense probably null
R2520:Hmcn1 UTSW 1 150,619,398 (GRCm39) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,528,326 (GRCm39) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,506,403 (GRCm39) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2849:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,678,624 (GRCm39) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,624,786 (GRCm39) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,565,269 (GRCm39) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,620,776 (GRCm39) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,678,575 (GRCm39) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,462,169 (GRCm39) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,525,328 (GRCm39) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,462,716 (GRCm39) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,566,361 (GRCm39) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,449,320 (GRCm39) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,598,204 (GRCm39) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,598,120 (GRCm39) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,648,253 (GRCm39) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,534,259 (GRCm39) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,471,750 (GRCm39) splice site probably null
R4441:Hmcn1 UTSW 1 150,533,210 (GRCm39) missense probably null
R4493:Hmcn1 UTSW 1 150,577,650 (GRCm39) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,509,417 (GRCm39) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,439,531 (GRCm39) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,610,238 (GRCm39) missense probably benign
R4601:Hmcn1 UTSW 1 150,614,396 (GRCm39) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,471,645 (GRCm39) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,551,262 (GRCm39) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,500,301 (GRCm39) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,494,816 (GRCm39) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,648,322 (GRCm39) splice site probably null
R4724:Hmcn1 UTSW 1 150,570,584 (GRCm39) splice site probably null
R4737:Hmcn1 UTSW 1 150,565,346 (GRCm39) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,453,363 (GRCm39) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,468,836 (GRCm39) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,553,130 (GRCm39) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,598,286 (GRCm39) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,752,111 (GRCm39) intron probably benign
R4968:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,695,200 (GRCm39) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,556,439 (GRCm39) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,613,007 (GRCm39) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,486,420 (GRCm39) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,532,492 (GRCm39) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,522,452 (GRCm39) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,471,612 (GRCm39) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,555,265 (GRCm39) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,458,047 (GRCm39) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,631,123 (GRCm39) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,498,995 (GRCm39) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,577,723 (GRCm39) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,485,576 (GRCm39) splice site probably null
R5531:Hmcn1 UTSW 1 150,619,539 (GRCm39) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,631,042 (GRCm39) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,613,257 (GRCm39) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,453,290 (GRCm39) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,532,318 (GRCm39) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,534,313 (GRCm39) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,485,529 (GRCm39) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,566,351 (GRCm39) nonsense probably null
R5718:Hmcn1 UTSW 1 150,485,417 (GRCm39) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,570,600 (GRCm39) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,634,225 (GRCm39) splice site probably null
R5739:Hmcn1 UTSW 1 150,684,448 (GRCm39) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,449,305 (GRCm39) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,570,629 (GRCm39) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,550,098 (GRCm39) nonsense probably null
R5809:Hmcn1 UTSW 1 150,525,358 (GRCm39) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,613,275 (GRCm39) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,868,774 (GRCm39) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,506,078 (GRCm39) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,474,648 (GRCm39) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,453,047 (GRCm39) nonsense probably null
R5940:Hmcn1 UTSW 1 150,532,973 (GRCm39) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,439,568 (GRCm39) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,579,924 (GRCm39) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,678,646 (GRCm39) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,508,188 (GRCm39) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,539,660 (GRCm39) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,646,081 (GRCm39) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,631,045 (GRCm39) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,631,044 (GRCm39) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,506,978 (GRCm39) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,494,687 (GRCm39) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,598,175 (GRCm39) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,441,176 (GRCm39) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,522,535 (GRCm39) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6276:Hmcn1 UTSW 1 150,614,432 (GRCm39) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,573,170 (GRCm39) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,573,227 (GRCm39) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,620,711 (GRCm39) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,868,670 (GRCm39) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,540,535 (GRCm39) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,553,053 (GRCm39) nonsense probably null
R6490:Hmcn1 UTSW 1 150,459,029 (GRCm39) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,573,317 (GRCm39) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6612:Hmcn1 UTSW 1 150,470,869 (GRCm39) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,599,008 (GRCm39) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,619,547 (GRCm39) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,634,057 (GRCm39) missense probably benign
R6687:Hmcn1 UTSW 1 150,620,784 (GRCm39) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,579,926 (GRCm39) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,610,269 (GRCm39) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,868,802 (GRCm39) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,475,404 (GRCm39) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,649,641 (GRCm39) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,479,853 (GRCm39) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,736,118 (GRCm39) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,479,997 (GRCm39) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,576,292 (GRCm39) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,452,961 (GRCm39) splice site probably null
R7144:Hmcn1 UTSW 1 150,539,624 (GRCm39) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,562,605 (GRCm39) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,624,744 (GRCm39) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,629,450 (GRCm39) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,525,331 (GRCm39) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,514,627 (GRCm39) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,598,394 (GRCm39) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,591,574 (GRCm39) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,458,088 (GRCm39) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,559,466 (GRCm39) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,608,880 (GRCm39) splice site probably null
R7316:Hmcn1 UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,479,565 (GRCm39) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,514,617 (GRCm39) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,559,496 (GRCm39) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,543,640 (GRCm39) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,682,196 (GRCm39) nonsense probably null
R7360:Hmcn1 UTSW 1 150,494,597 (GRCm39) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,439,382 (GRCm39) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,522,421 (GRCm39) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,550,181 (GRCm39) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,596,510 (GRCm39) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,506,017 (GRCm39) nonsense probably null
R7454:Hmcn1 UTSW 1 150,439,355 (GRCm39) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,456,018 (GRCm39) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,552,985 (GRCm39) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,498,718 (GRCm39) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,532,324 (GRCm39) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,562,531 (GRCm39) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,480,625 (GRCm39) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,531,586 (GRCm39) missense probably benign
R7588:Hmcn1 UTSW 1 150,532,885 (GRCm39) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,441,080 (GRCm39) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,522,460 (GRCm39) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,543,631 (GRCm39) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,598,196 (GRCm39) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,632,343 (GRCm39) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,646,030 (GRCm39) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,682,172 (GRCm39) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,620,722 (GRCm39) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,468,940 (GRCm39) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,540,643 (GRCm39) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,525,835 (GRCm39) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,531,606 (GRCm39) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,540,629 (GRCm39) nonsense probably null
R8015:Hmcn1 UTSW 1 150,474,062 (GRCm39) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,525,743 (GRCm39) nonsense probably null
R8072:Hmcn1 UTSW 1 150,532,256 (GRCm39) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,624,841 (GRCm39) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,734,957 (GRCm39) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,629,411 (GRCm39) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,480,705 (GRCm39) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,522,409 (GRCm39) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,598,265 (GRCm39) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,453,228 (GRCm39) nonsense probably null
R8234:Hmcn1 UTSW 1 150,469,761 (GRCm39) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,695,117 (GRCm39) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,735,005 (GRCm39) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,614,515 (GRCm39) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,614,485 (GRCm39) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,634,142 (GRCm39) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,570,671 (GRCm39) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,479,551 (GRCm39) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,455,990 (GRCm39) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,449,302 (GRCm39) nonsense probably null
R8559:Hmcn1 UTSW 1 150,551,789 (GRCm39) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,631,008 (GRCm39) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,509,371 (GRCm39) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,556,413 (GRCm39) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,540,636 (GRCm39) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,591,469 (GRCm39) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,610,248 (GRCm39) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,531,570 (GRCm39) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,547,726 (GRCm39) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,514,659 (GRCm39) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,525,723 (GRCm39) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,649,530 (GRCm39) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,630,795 (GRCm39) intron probably benign
R9030:Hmcn1 UTSW 1 150,692,870 (GRCm39) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,565,320 (GRCm39) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,532,869 (GRCm39) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,573,331 (GRCm39) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,474,141 (GRCm39) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,506,092 (GRCm39) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,488,405 (GRCm39) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,500,337 (GRCm39) nonsense probably null
R9204:Hmcn1 UTSW 1 150,610,262 (GRCm39) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,594,844 (GRCm39) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,473,740 (GRCm39) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,506,046 (GRCm39) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,545,187 (GRCm39) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,506,053 (GRCm39) nonsense probably null
R9464:Hmcn1 UTSW 1 150,599,248 (GRCm39) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,506,471 (GRCm39) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,610,281 (GRCm39) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,579,971 (GRCm39) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,470,990 (GRCm39) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,545,175 (GRCm39) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,498,660 (GRCm39) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,475,303 (GRCm39) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,555,346 (GRCm39) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,684,473 (GRCm39) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,506,054 (GRCm39) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,619,492 (GRCm39) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,613,356 (GRCm39) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,485,378 (GRCm39) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,674,566 (GRCm39) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,623,941 (GRCm39) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,632,339 (GRCm39) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,868,625 (GRCm39) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,598,380 (GRCm39) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,528,333 (GRCm39) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,684,391 (GRCm39) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,500,312 (GRCm39) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,510,897 (GRCm39) nonsense probably null
X0022:Hmcn1 UTSW 1 150,576,281 (GRCm39) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,736,127 (GRCm39) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,539,652 (GRCm39) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,524,688 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,539,668 (GRCm39) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,531,672 (GRCm39) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,462,196 (GRCm39) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- GAGGGAAAACACTGGCTTTGTC -3'
(R):5'- GCGCTGTAAATACGTCTCATCTG -3'

Sequencing Primer
(F):5'- GAAAACACTGGCTTTGTCTTGTTC -3'
(R):5'- CTGTAAATACGTCTCATCTGAAACAG -3'
Posted On 2018-02-27