Mutagenetix > Incidental Mutations

Incidental Mutation 'R6187:Trio'

502266

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

044327-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6187 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 27743952 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]

Predicted Effect

probably null
Transcript: ENSMUST00000090247

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226644

Predicted Effect

probably null
Transcript: ENSMUST00000226713

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227642

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228084

Meta Mutation Damage Score

0.9595

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	G	A	7: 131,270,599		probably benign	Het
Abca13	T	A	11: 9,309,085	L2937H	probably damaging	Het
Abca3	A	G	17: 24,408,167	I1281V	possibly damaging	Het
Adam2	A	T	14: 66,068,619	S138T	possibly damaging	Het
Adamts4	C	T	1: 171,250,993	P61S	probably damaging	Het
Adamts6	C	T	13: 104,297,425	P121S	probably damaging	Het
AF529169	A	G	9: 89,591,167	I897T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ak1	G	A	2: 32,633,477	V186M	probably damaging	Het
Alpk1	T	C	3: 127,673,342	Y1096C	probably damaging	Het
Ankrd29	A	C	18: 12,279,690	Y73*	probably null	Het
Asah2	A	T	19: 32,024,867	S292R	probably damaging	Het
Atp6v1b1	A	T	6: 83,752,395	T105S	probably damaging	Het
Axdnd1	T	A	1: 156,365,612		probably null	Het
Bub1b	T	G	2: 118,631,000	S678A	probably damaging	Het
Cenpq	T	A	17: 40,927,198	M142L	probably benign	Het
Ciz1	T	A	2: 32,370,051	V203E	possibly damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Cyp2c68	A	T	19: 39,741,008	S12T	probably benign	Het
Cyp4f18	C	A	8: 71,993,186	A322S	probably damaging	Het
Disp2	A	G	2: 118,792,143	S1119G	probably damaging	Het
Eif2ak4	C	T	2: 118,457,157	T1081M	probably damaging	Het
Faxc	A	G	4: 21,958,445	T201A	possibly damaging	Het
Fbxw14	A	G	9: 109,276,264	S278P	probably damaging	Het
Fpr1	G	T	17: 17,876,928	C266*	probably null	Het
Fsip2	T	C	2: 82,982,454	I3039T	probably benign	Het
Gas1	G	T	13: 60,176,372	S190R	possibly damaging	Het
Gemin2	A	G	12: 59,013,585	T37A	probably damaging	Het
Gm21370	T	C	13: 120,026,867	I49V	probably benign	Het
Gm8444	T	C	15: 81,843,606		probably benign	Het
Gpr1	T	C	1: 63,183,275	E267G	probably damaging	Het
Gria1	A	G	11: 57,238,110	D401G	possibly damaging	Het
Gstk1	G	A	6: 42,249,860	V187I	possibly damaging	Het
Hmcn1	T	C	1: 150,630,728	D3776G	probably damaging	Het
Itfg1	A	C	8: 85,836,465	V102G	probably damaging	Het
Kidins220	A	G	12: 25,051,308		probably null	Het
Kif13b	A	C	14: 64,736,215	D338A	probably damaging	Het
Mab21l2	T	C	3: 86,547,258	Y145C	probably damaging	Het
Magel2	A	G	7: 62,377,641	M98V	unknown	Het
Mdfic	T	C	6: 15,721,197		probably benign	Het
Mlip	G	A	9: 77,230,482	S381L	probably damaging	Het
Mycbp2	A	G	14: 103,147,017	L3475P	probably damaging	Het
Myh14	G	A	7: 44,627,033	T1216I	probably damaging	Het
Nfatc2	T	A	2: 168,480,238	I914F	probably benign	Het
Nupl1	T	C	14: 60,240,807		probably null	Het
Olfr1115	T	A	2: 87,252,698	S254T	probably damaging	Het
Olfr120	T	C	17: 37,726,141	L48P	probably damaging	Het
Olfr1383	G	T	11: 49,523,511		probably benign	Het
Olfr469	A	T	7: 107,822,574	N298K	probably benign	Het
Olfr535	A	G	7: 140,492,616		probably benign	Het
Olfr724	A	G	14: 49,961,069	M1T	probably null	Het
Olfr835	A	C	9: 19,035,393	Q90P	probably benign	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Oxr1	A	G	15: 41,825,919	Q513R	probably damaging	Het
Padi1	C	T	4: 140,826,965	V310M	probably damaging	Het
Pard3	T	C	8: 127,073,273	L11S	probably benign	Het
Pcdhb14	A	T	18: 37,448,444	D201V	probably damaging	Het
Pcdhb7	A	G	18: 37,342,569	R253G	probably benign	Het
Plxnb2	C	T	15: 89,167,258	D253N	probably damaging	Het
Ppp2cb	T	C	8: 33,615,474	S171P	probably damaging	Het
Prr5	C	T	15: 84,693,772	T94M	probably damaging	Het
Rp1	A	G	1: 4,349,869	F340S	probably damaging	Het
Rpa1	C	G	11: 75,310,236	G433A	probably benign	Het
Smg1	A	T	7: 118,189,163		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Homo
Svep1	C	T	4: 58,072,872	G2146R	probably damaging	Het
Tas2r106	A	G	6: 131,678,210	M226T	probably damaging	Het
Tbk1	T	C	10: 121,584,243	I14V	probably benign	Het
Tekt4	G	C	17: 25,472,223	V168L	probably damaging	Het
Tnfaip1	T	A	11: 78,527,546	T232S	probably damaging	Het
Ttn	T	A	2: 76,944,437	Y2133F	unknown	Het
Uap1l1	C	T	2: 25,362,729	R433H	probably damaging	Het
Ugt2b35	T	C	5: 87,007,322	F339L	probably damaging	Het
Unc5b	T	C	10: 60,772,224	Y699C	probably damaging	Het
Vcpip1	T	C	1: 9,724,780	H1122R	probably damaging	Het
Vmn2r91	T	C	17: 18,106,626	V391A	probably benign	Het
Vps13c	C	T	9: 67,915,657	R1327W	probably damaging	Het
Yes1	A	G	5: 32,645,041	Y100C	probably damaging	Het
Zfp407	A	T	18: 84,559,009	N1326K	possibly damaging	Het
Zfp518a	G	A	19: 40,915,446	C1273Y	probably benign	Het
Zfr	AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA	AGCAGCAGCA	15: 12,146,231		probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTCCCTGGATATTTAGTGACC -3'
(R):5'- AACGTCTATCAAGGAGAGGTCG -3'

Sequencing Primer
(F):5'- CCTGGATATTTAGTGACCCGAAC -3'
(R):5'- AGAGGTCGTTCAAATTCTGGCC -3'

Posted On

2018-02-27