Incidental Mutation 'R6187:Trio'
ID502266
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 044327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6187 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 27743952 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]
Predicted Effect probably null
Transcript: ENSMUST00000090247
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226644
Predicted Effect probably null
Transcript: ENSMUST00000226713
Predicted Effect probably benign
Transcript: ENSMUST00000227030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228084
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,270,599 probably benign Het
Abca13 T A 11: 9,309,085 L2937H probably damaging Het
Abca3 A G 17: 24,408,167 I1281V possibly damaging Het
Adam2 A T 14: 66,068,619 S138T possibly damaging Het
Adamts4 C T 1: 171,250,993 P61S probably damaging Het
Adamts6 C T 13: 104,297,425 P121S probably damaging Het
AF529169 A G 9: 89,591,167 I897T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ak1 G A 2: 32,633,477 V186M probably damaging Het
Alpk1 T C 3: 127,673,342 Y1096C probably damaging Het
Ankrd29 A C 18: 12,279,690 Y73* probably null Het
Asah2 A T 19: 32,024,867 S292R probably damaging Het
Atp6v1b1 A T 6: 83,752,395 T105S probably damaging Het
Axdnd1 T A 1: 156,365,612 probably null Het
Bub1b T G 2: 118,631,000 S678A probably damaging Het
Cenpq T A 17: 40,927,198 M142L probably benign Het
Ciz1 T A 2: 32,370,051 V203E possibly damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Cyp2c68 A T 19: 39,741,008 S12T probably benign Het
Cyp4f18 C A 8: 71,993,186 A322S probably damaging Het
Disp2 A G 2: 118,792,143 S1119G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Faxc A G 4: 21,958,445 T201A possibly damaging Het
Fbxw14 A G 9: 109,276,264 S278P probably damaging Het
Fpr1 G T 17: 17,876,928 C266* probably null Het
Fsip2 T C 2: 82,982,454 I3039T probably benign Het
Gas1 G T 13: 60,176,372 S190R possibly damaging Het
Gemin2 A G 12: 59,013,585 T37A probably damaging Het
Gm21370 T C 13: 120,026,867 I49V probably benign Het
Gm8444 T C 15: 81,843,606 probably benign Het
Gpr1 T C 1: 63,183,275 E267G probably damaging Het
Gria1 A G 11: 57,238,110 D401G possibly damaging Het
Gstk1 G A 6: 42,249,860 V187I possibly damaging Het
Hmcn1 T C 1: 150,630,728 D3776G probably damaging Het
Itfg1 A C 8: 85,836,465 V102G probably damaging Het
Kidins220 A G 12: 25,051,308 probably null Het
Kif13b A C 14: 64,736,215 D338A probably damaging Het
Mab21l2 T C 3: 86,547,258 Y145C probably damaging Het
Magel2 A G 7: 62,377,641 M98V unknown Het
Mdfic T C 6: 15,721,197 probably benign Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mycbp2 A G 14: 103,147,017 L3475P probably damaging Het
Myh14 G A 7: 44,627,033 T1216I probably damaging Het
Nfatc2 T A 2: 168,480,238 I914F probably benign Het
Nupl1 T C 14: 60,240,807 probably null Het
Olfr1115 T A 2: 87,252,698 S254T probably damaging Het
Olfr120 T C 17: 37,726,141 L48P probably damaging Het
Olfr1383 G T 11: 49,523,511 probably benign Het
Olfr469 A T 7: 107,822,574 N298K probably benign Het
Olfr535 A G 7: 140,492,616 probably benign Het
Olfr724 A G 14: 49,961,069 M1T probably null Het
Olfr835 A C 9: 19,035,393 Q90P probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Oxr1 A G 15: 41,825,919 Q513R probably damaging Het
Padi1 C T 4: 140,826,965 V310M probably damaging Het
Pard3 T C 8: 127,073,273 L11S probably benign Het
Pcdhb14 A T 18: 37,448,444 D201V probably damaging Het
Pcdhb7 A G 18: 37,342,569 R253G probably benign Het
Plxnb2 C T 15: 89,167,258 D253N probably damaging Het
Ppp2cb T C 8: 33,615,474 S171P probably damaging Het
Prr5 C T 15: 84,693,772 T94M probably damaging Het
Rp1 A G 1: 4,349,869 F340S probably damaging Het
Rpa1 C G 11: 75,310,236 G433A probably benign Het
Smg1 A T 7: 118,189,163 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Homo
Svep1 C T 4: 58,072,872 G2146R probably damaging Het
Tas2r106 A G 6: 131,678,210 M226T probably damaging Het
Tbk1 T C 10: 121,584,243 I14V probably benign Het
Tekt4 G C 17: 25,472,223 V168L probably damaging Het
Tnfaip1 T A 11: 78,527,546 T232S probably damaging Het
Ttn T A 2: 76,944,437 Y2133F unknown Het
Uap1l1 C T 2: 25,362,729 R433H probably damaging Het
Ugt2b35 T C 5: 87,007,322 F339L probably damaging Het
Unc5b T C 10: 60,772,224 Y699C probably damaging Het
Vcpip1 T C 1: 9,724,780 H1122R probably damaging Het
Vmn2r91 T C 17: 18,106,626 V391A probably benign Het
Vps13c C T 9: 67,915,657 R1327W probably damaging Het
Yes1 A G 5: 32,645,041 Y100C probably damaging Het
Zfp407 A T 18: 84,559,009 N1326K possibly damaging Het
Zfp518a G A 19: 40,915,446 C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,231 probably benign Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCCCTGGATATTTAGTGACC -3'
(R):5'- AACGTCTATCAAGGAGAGGTCG -3'

Sequencing Primer
(F):5'- CCTGGATATTTAGTGACCCGAAC -3'
(R):5'- AGAGGTCGTTCAAATTCTGGCC -3'
Posted On2018-02-27