Incidental Mutation 'R6188:Lmbrd1'
ID502288
Institutional Source Beutler Lab
Gene Symbol Lmbrd1
Ensembl Gene ENSMUSG00000073725
Gene NameLMBR1 domain containing 1
Synonyms0910001K20Rik
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24678630-24766301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24711545 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 166 (N166K)
Ref Sequence ENSEMBL: ENSMUSP00000140783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095062] [ENSMUST00000186096] [ENSMUST00000186190] [ENSMUST00000191471]
Predicted Effect probably benign
Transcript: ENSMUST00000095062
AA Change: N96K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092672
Gene: ENSMUSG00000073725
AA Change: N96K

DomainStartEndE-ValueType
Pfam:LMBR1 17 292 3e-24 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186096
SMART Domains Protein: ENSMUSP00000140911
Gene: ENSMUSG00000073725

DomainStartEndE-ValueType
Pfam:LMBR1 12 155 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186190
SMART Domains Protein: ENSMUSP00000139893
Gene: ENSMUSG00000073725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191471
AA Change: N166K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140783
Gene: ENSMUSG00000073725
AA Change: N166K

DomainStartEndE-ValueType
Pfam:LMBR1 12 289 2.7e-19 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice heterozygous for a targeted allele exhibit increased cardiac cell glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Lmbrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Lmbrd1 APN 1 24705974 splice site probably benign
IGL01897:Lmbrd1 APN 1 24743896 missense possibly damaging 0.47
IGL01950:Lmbrd1 APN 1 24711602 critical splice donor site probably null
IGL02342:Lmbrd1 APN 1 24704878 missense probably damaging 1.00
IGL02888:Lmbrd1 APN 1 24714972 missense possibly damaging 0.94
P0033:Lmbrd1 UTSW 1 24685565 missense possibly damaging 0.95
R0479:Lmbrd1 UTSW 1 24746797 splice site probably benign
R0549:Lmbrd1 UTSW 1 24744920 missense probably benign 0.17
R1015:Lmbrd1 UTSW 1 24731878 nonsense probably null
R1423:Lmbrd1 UTSW 1 24746878 missense probably damaging 0.99
R1636:Lmbrd1 UTSW 1 24746930 nonsense probably null
R1650:Lmbrd1 UTSW 1 24711558 missense probably damaging 0.97
R1815:Lmbrd1 UTSW 1 24685561 missense possibly damaging 0.55
R2354:Lmbrd1 UTSW 1 24685541 missense probably damaging 1.00
R3690:Lmbrd1 UTSW 1 24762293 makesense probably null
R3713:Lmbrd1 UTSW 1 24692995 missense probably damaging 1.00
R4241:Lmbrd1 UTSW 1 24692968 nonsense probably null
R4627:Lmbrd1 UTSW 1 24705999 missense probably damaging 1.00
R4782:Lmbrd1 UTSW 1 24744975 splice site probably null
R4799:Lmbrd1 UTSW 1 24744975 splice site probably null
R5341:Lmbrd1 UTSW 1 24746811 nonsense probably null
R5430:Lmbrd1 UTSW 1 24692980 missense possibly damaging 0.95
R5483:Lmbrd1 UTSW 1 24744908 missense probably damaging 1.00
R5633:Lmbrd1 UTSW 1 24748862 missense possibly damaging 0.90
R6383:Lmbrd1 UTSW 1 24706034 missense probably damaging 0.99
R6617:Lmbrd1 UTSW 1 24685428 missense probably damaging 1.00
R7060:Lmbrd1 UTSW 1 24692966 missense probably benign 0.00
R7365:Lmbrd1 UTSW 1 24744867 missense possibly damaging 0.62
R7621:Lmbrd1 UTSW 1 24728544 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAATAAAGTAAGTCCGTCAG -3'
(R):5'- GTGTAAACCTCCTCACCGAAG -3'

Sequencing Primer
(F):5'- GGCATGGATTTGGGAGAAT -3'
(R):5'- GTGTAAACCTCCTCACCGAAGTACAG -3'
Posted On2018-02-27