Incidental Mutation 'R6188:Or4a72'
ID 502295
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 044328-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R6188 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 89405538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 177 (C177*)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably null
Transcript: ENSMUST00000214870
AA Change: C177*
Predicted Effect probably null
Transcript: ENSMUST00000217402
AA Change: C177*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,331,850 (GRCm39) I88F possibly damaging Het
4930407I10Rik T C 15: 81,943,471 (GRCm39) S28P probably benign Het
a A T 2: 154,889,602 (GRCm39) N56I probably damaging Het
Apoe C A 7: 19,432,305 (GRCm39) probably benign Het
Aspm C A 1: 139,406,977 (GRCm39) R1955S possibly damaging Het
Boc G A 16: 44,319,911 (GRCm39) L358F possibly damaging Het
Cadm2 A T 16: 66,612,195 (GRCm39) probably null Het
Ccdc183 T C 2: 25,499,764 (GRCm39) E384G probably benign Het
Ccl12 A G 11: 81,993,943 (GRCm39) T67A probably damaging Het
Cep120 T C 18: 53,857,529 (GRCm39) D312G probably benign Het
Cmya5 A G 13: 93,229,952 (GRCm39) V1712A possibly damaging Het
Cmya5 A G 13: 93,233,784 (GRCm39) S435P possibly damaging Het
Dmbt1 A T 7: 130,699,361 (GRCm39) N997Y probably damaging Het
Dock2 T A 11: 34,453,396 (GRCm39) I86F probably damaging Het
Duox1 A G 2: 122,150,275 (GRCm39) Q168R probably benign Het
Epb41l4a T A 18: 33,965,718 (GRCm39) I370L probably benign Het
Erc2 T A 14: 28,039,208 (GRCm39) D950E probably damaging Het
Exoc6b A G 6: 84,832,479 (GRCm39) V405A probably damaging Het
F13a1 T C 13: 37,209,752 (GRCm39) D71G probably benign Het
Fam151a A T 4: 106,602,696 (GRCm39) Y205F possibly damaging Het
Fcnb C A 2: 27,969,202 (GRCm39) R165M possibly damaging Het
Fndc3a C T 14: 72,827,401 (GRCm39) V50I probably damaging Het
Gm13276 C T 4: 88,704,096 (GRCm39) Q51* probably null Het
Grik1 T C 16: 87,852,959 (GRCm39) T75A probably benign Het
Grip2 A G 6: 91,740,514 (GRCm39) L1015P probably damaging Het
Hnrnpk A G 13: 58,541,967 (GRCm39) F339L probably benign Het
Iqgap3 A G 3: 88,006,200 (GRCm39) D537G probably benign Het
Kars1 C T 8: 112,735,113 (GRCm39) probably null Het
Kpna7 G T 5: 144,929,654 (GRCm39) N390K probably damaging Het
Krt36 A T 11: 99,993,246 (GRCm39) S410T probably benign Het
Lingo4 A G 3: 94,310,157 (GRCm39) E365G probably damaging Het
Liph T C 16: 21,803,018 (GRCm39) D17G probably benign Het
Lmbrd1 C A 1: 24,750,626 (GRCm39) N166K probably benign Het
Lypd9 T C 11: 58,337,182 (GRCm39) E97G probably benign Het
Nup155 T C 15: 8,139,059 (GRCm39) S44P probably damaging Het
Or2m12 A G 16: 19,105,307 (GRCm39) M62T probably damaging Het
Or5a3 A G 19: 12,399,974 (GRCm39) I100M probably benign Het
Pcdhga6 T C 18: 37,841,324 (GRCm39) V348A probably benign Het
Phc3 G A 3: 30,991,198 (GRCm39) Q295* probably null Het
Phyh A G 2: 4,932,301 (GRCm39) E129G probably damaging Het
Polb A G 8: 23,137,463 (GRCm39) S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 (GRCm39) K1174* probably null Het
Ppp1r9b C T 11: 94,882,662 (GRCm39) R97W probably damaging Het
Pttg1ip T C 10: 77,418,342 (GRCm39) probably null Het
Pygm G A 19: 6,447,967 (GRCm39) probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,091,106 (GRCm39) probably null Het
Rlf T C 4: 121,027,963 (GRCm39) H111R probably damaging Het
Rmdn3 A G 2: 118,969,831 (GRCm39) probably null Het
Ror2 T A 13: 53,265,347 (GRCm39) T570S probably damaging Het
Sel1l3 A C 5: 53,313,061 (GRCm39) I542R possibly damaging Het
Serpinb3d A G 1: 107,006,237 (GRCm39) F284L probably damaging Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc38a2 A G 15: 96,590,397 (GRCm39) probably null Het
Spata31e2 T A 1: 26,724,784 (GRCm39) Y132F probably damaging Het
Spata31h1 A G 10: 82,121,091 (GRCm39) I3973T probably damaging Het
Tet2 T C 3: 133,186,087 (GRCm39) S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,797,414 (GRCm39) A21V probably damaging Het
Tsr3 G T 17: 25,460,835 (GRCm39) D234Y probably null Het
Vmn1r220 A T 13: 23,368,084 (GRCm39) L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 (GRCm39) S97T probably damaging Het
Zfp599 A G 9: 22,161,286 (GRCm39) F293S probably damaging Het
Zfp983 A G 17: 21,877,935 (GRCm39) Y46C probably damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAACTGGTCGGGCATAC -3'
(R):5'- TGGCAATCTGTAAGCCACTG -3'

Sequencing Primer
(F):5'- CTGGTCGGGCATACATAAAAATAC -3'
(R):5'- GTAAGCCACTGCACTATTTGG -3'
Posted On 2018-02-27