Incidental Mutation 'R6188:Olfr1245'
ID502295
Institutional Source Beutler Lab
Gene Symbol Olfr1245
Ensembl Gene ENSMUSG00000111456
Gene Nameolfactory receptor 1245
SynonymsGA_x6K02T2Q125-51020951-51020028, MOR231-12
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89573406-89578447 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 89575194 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 177 (C177*)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000214870
AA Change: C177*
Predicted Effect probably null
Transcript: ENSMUST00000217402
AA Change: C177*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Olfr1245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Olfr1245 APN 2 89575423 missense possibly damaging 0.68
IGL01690:Olfr1245 APN 2 89575213 missense probably benign 0.09
IGL02334:Olfr1245 APN 2 89575324 missense possibly damaging 0.95
IGL02435:Olfr1245 APN 2 89575546 missense probably damaging 0.99
IGL02793:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL02875:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL03218:Olfr1245 APN 2 89575591 missense probably benign 0.09
IGL03392:Olfr1245 APN 2 89575249 missense probably damaging 0.96
H8786:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
I0000:Olfr1245 UTSW 2 89575153 missense probably damaging 1.00
R0044:Olfr1245 UTSW 2 89575630 missense possibly damaging 0.68
R0190:Olfr1245 UTSW 2 89574958 missense probably damaging 0.98
R1585:Olfr1245 UTSW 2 89575402 missense possibly damaging 0.89
R1902:Olfr1245 UTSW 2 89575603 missense possibly damaging 0.77
R2018:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2019:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2020:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2021:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2030:Olfr1245 UTSW 2 89575214 missense probably benign 0.00
R2133:Olfr1245 UTSW 2 89575256 nonsense probably null
R3850:Olfr1245 UTSW 2 89575034 missense probably damaging 0.99
R4066:Olfr1245 UTSW 2 89575179 missense probably damaging 1.00
R4754:Olfr1245 UTSW 2 89575047 missense probably benign
R4923:Olfr1245 UTSW 2 89575679 missense probably damaging 0.98
R5303:Olfr1245 UTSW 2 89575001 missense possibly damaging 0.88
R5574:Olfr1245 UTSW 2 89574977 missense possibly damaging 0.94
R6083:Olfr1245 UTSW 2 89575672 missense probably benign 0.42
R6724:Olfr1245 UTSW 2 89574965 missense probably benign 0.26
R6964:Olfr1245 UTSW 2 89574989 missense probably benign
R7066:Olfr1245 UTSW 2 89575703 missense probably damaging 0.98
R7401:Olfr1245 UTSW 2 89575105 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTAAACTGGTCGGGCATAC -3'
(R):5'- TGGCAATCTGTAAGCCACTG -3'

Sequencing Primer
(F):5'- CTGGTCGGGCATACATAAAAATAC -3'
(R):5'- GTAAGCCACTGCACTATTTGG -3'
Posted On2018-02-27