Incidental Mutation 'R6188:a'
ID502298
Institutional Source Beutler Lab
Gene Symbol a
Ensembl Gene ENSMUSG00000027596
Gene Namenonagouti
SynonymsASP, As, agouti, agouti signal protein
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154791402-155051012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155047682 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 56 (N56I)
Ref Sequence ENSEMBL: ENSMUSP00000122261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029123] [ENSMUST00000109697] [ENSMUST00000137333] [ENSMUST00000148402]
Predicted Effect probably damaging
Transcript: ENSMUST00000029123
AA Change: N56I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029123
Gene: ENSMUSG00000027596
AA Change: N56I

DomainStartEndE-ValueType
Agouti 6 127 3.98e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109697
AA Change: N56I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105319
Gene: ENSMUSG00000027596
AA Change: N56I

DomainStartEndE-ValueType
Agouti 6 127 3.98e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132342
Predicted Effect probably damaging
Transcript: ENSMUST00000137333
AA Change: N56I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596
AA Change: N56I

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148300
Predicted Effect probably damaging
Transcript: ENSMUST00000148402
AA Change: N56I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121072
Gene: ENSMUSG00000027596
AA Change: N56I

DomainStartEndE-ValueType
Agouti 6 75 2.32e-6 SMART
Meta Mutation Damage Score 0.2748 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mice, the agouti gene encodes a paracrine signaling molecule that causes hair follicle melanocytes to synthesize pheomelanin, a yellow pigment, instead of the black or brown pigment, eumelanin. Pleiotropic effects of constitutive expression of the mouse gene include adult-onset obesity, increased tumor susceptibility, and premature infertility. This gene is highly similar to the mouse gene and encodes a secreted protein that may (1) affect the quality of hair pigmentation, (2) act as a pharmacological antagonist of alpha-melanocyte-stimulating hormone, (3) play a role in neuroendocrine aspects of melanocortin action, and (4) have a functional role in regulating lipid metabolism in adipocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Agouti acts in the hair follicles, primarily affecting the relative amount and distribution of yellow pigment (phaeomelanin) and black pigment (eumelanin) in hairs of the coat. Some alleles show lethal effects or are associated with obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:a APN 2 155045673 missense probably benign 0.00
IGL02421:a APN 2 155050752 missense probably damaging 0.98
garfield UTSW 2 unclassified
killer_whale UTSW 2 unclassified
Split UTSW 2 unclassified
yellowbelly UTSW 2 unclassified
R0670:a UTSW 2 155045758 missense probably damaging 1.00
R2114:a UTSW 2 155047729 missense probably benign
R4082:a UTSW 2 155045758 missense probably damaging 1.00
R4346:a UTSW 2 155045731 missense probably benign 0.20
R6476:a UTSW 2 155050779 missense probably benign 0.00
R7211:a UTSW 2 155045779 missense probably damaging 1.00
R7295:a UTSW 2 155045758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCAGGCTAATCAGAACCTG -3'
(R):5'- AAGCCTTAAGACTCTAGGCCGG -3'

Sequencing Primer
(F):5'- CAGAACCTGATGGCTTGATTCCG -3'
(R):5'- GCTTACCTTGGAAGACCT -3'
Posted On2018-02-27