Incidental Mutation 'R6188:Ppp1r9b'
ID502323
Institutional Source Beutler Lab
Gene Symbol Ppp1r9b
Ensembl Gene ENSMUSG00000038976
Gene Nameprotein phosphatase 1, regulatory subunit 9B
SynonymsSPL, Spn, spinophilin, neurabin II
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6188 (G1)
Quality Score92.0077
Status Validated
Chromosome11
Chromosomal Location94991035-95006899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94991836 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 97 (R97W)
Ref Sequence ENSEMBL: ENSMUSP00000041732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038696] [ENSMUST00000107748]
Predicted Effect probably damaging
Transcript: ENSMUST00000038696
AA Change: R97W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041732
Gene: ENSMUSG00000038976
AA Change: R97W

DomainStartEndE-ValueType
low complexity region 64 83 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 253 260 N/A INTRINSIC
low complexity region 281 317 N/A INTRINSIC
low complexity region 332 361 N/A INTRINSIC
low complexity region 399 430 N/A INTRINSIC
Blast:PDZ 431 458 4e-10 BLAST
PDZ 504 584 7.03e-19 SMART
low complexity region 600 612 N/A INTRINSIC
Blast:PDZ 731 768 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107748
SMART Domains Protein: ENSMUSP00000103377
Gene: ENSMUSG00000038976

DomainStartEndE-ValueType
PDZ 80 160 7.03e-19 SMART
low complexity region 176 188 N/A INTRINSIC
Blast:PDZ 307 344 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151771
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal glutamatergic synaptic transmission, reduced long-term depression, resistance to kainate-induced seizures, impaired taste aversion learning, and increased dendritic spine density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Ppp1r9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Ppp1r9b APN 11 95005354 missense probably damaging 0.96
IGL02261:Ppp1r9b APN 11 95002110 missense probably damaging 1.00
R0068:Ppp1r9b UTSW 11 95001220 missense probably damaging 1.00
R0719:Ppp1r9b UTSW 11 95001835 splice site probably null
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1385:Ppp1r9b UTSW 11 94992211 missense probably benign 0.06
R1639:Ppp1r9b UTSW 11 94996610 missense probably damaging 1.00
R1642:Ppp1r9b UTSW 11 95001324 synonymous silent
R2000:Ppp1r9b UTSW 11 94996620 missense probably damaging 1.00
R2162:Ppp1r9b UTSW 11 94998051 missense probably damaging 1.00
R2332:Ppp1r9b UTSW 11 94996609 missense probably damaging 0.96
R3815:Ppp1r9b UTSW 11 94992533 missense probably damaging 1.00
R4426:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R4427:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R5121:Ppp1r9b UTSW 11 94996653 missense probably damaging 0.99
R5205:Ppp1r9b UTSW 11 95001298 missense probably benign 0.11
R5348:Ppp1r9b UTSW 11 94996612 nonsense probably null
R5397:Ppp1r9b UTSW 11 95002110 missense probably damaging 1.00
R5399:Ppp1r9b UTSW 11 94992148 missense probably benign
R6860:Ppp1r9b UTSW 11 94992148 missense probably benign
R7308:Ppp1r9b UTSW 11 95004571 missense possibly damaging 0.86
R7357:Ppp1r9b UTSW 11 95004598 missense probably benign 0.00
R7479:Ppp1r9b UTSW 11 94992032 missense possibly damaging 0.85
R7587:Ppp1r9b UTSW 11 95001940 missense possibly damaging 0.65
R7651:Ppp1r9b UTSW 11 95001942 missense probably benign 0.03
R7871:Ppp1r9b UTSW 11 95001909 missense probably damaging 1.00
R7954:Ppp1r9b UTSW 11 95001909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGAAGACGGAGCCTCG -3'
(R):5'- AGTCGGCTTTCTCGAAGACC -3'

Sequencing Primer
(F):5'- CGGGCATCCAGGCACTAAAG -3'
(R):5'- TTTCTCGAAGACCGCACTGAG -3'
Posted On2018-02-27