Mutagenetix > Incidental Mutation

Incidental Mutation 'R6188:Krt36'

502324

Institutional Source

Beutler Lab

Gene Symbol

Krt36

Ensembl Gene

ENSMUSG00000020916

Gene Name

keratin 36

Synonyms

Krt1-22, keratin 5, HRa-1, Krt1-5

MMRRC Submission

044328-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R6188 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100102007-100105626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100102420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 410 (S410T)

Ref Sequence

ENSEMBL: ENSMUSP00000103039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107416]

AlphaFold

B1AQ75

Predicted Effect

probably benign
Transcript: ENSMUST00000107416
AA Change: S410T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: S410T

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Filament	92	403	4.05e-163	SMART
low complexity region	425	443	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127883

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,183,731	I88F	possibly damaging	Het
4930407I10Rik	T	C	15: 82,059,270	S28P	probably benign	Het
4930504O13Rik	T	C	11: 58,446,356	E97G	probably benign	Het
4931408C20Rik	T	A	1: 26,685,703	Y132F	probably damaging	Het
4932415D10Rik	A	G	10: 82,285,257	I3973T	probably damaging	Het
a	A	T	2: 155,047,682	N56I	probably damaging	Het
Apoe	C	A	7: 19,698,380		probably benign	Het
Aspm	C	A	1: 139,479,239	R1955S	possibly damaging	Het
Boc	G	A	16: 44,499,548	L358F	possibly damaging	Het
Cadm2	A	T	16: 66,815,307		probably null	Het
Ccdc183	T	C	2: 25,609,752	E384G	probably benign	Het
Ccl12	A	G	11: 82,103,117	T67A	probably damaging	Het
Cep120	T	C	18: 53,724,457	D312G	probably benign	Het
Cmya5	A	G	13: 93,093,444	V1712A	possibly damaging	Het
Cmya5	A	G	13: 93,097,276	S435P	possibly damaging	Het
Dmbt1	A	T	7: 131,097,631	N997Y	probably damaging	Het
Dock2	T	A	11: 34,503,396	I86F	probably damaging	Het
Duox1	A	G	2: 122,319,794	Q168R	probably benign	Het
Epb41l4a	T	A	18: 33,832,665	I370L	probably benign	Het
Erc2	T	A	14: 28,317,251	D950E	probably damaging	Het
Exoc6b	A	G	6: 84,855,497	V405A	probably damaging	Het
F13a1	T	C	13: 37,025,778	D71G	probably benign	Het
Fam151a	A	T	4: 106,745,499	Y205F	possibly damaging	Het
Fcnb	C	A	2: 28,079,190	R165M	possibly damaging	Het
Fndc3a	C	T	14: 72,589,961	V50I	probably damaging	Het
Gm13276	C	T	4: 88,785,859	Q51*	probably null	Het
Grik1	T	C	16: 88,056,071	T75A	probably benign	Het
Grip2	A	G	6: 91,763,533	L1015P	probably damaging	Het
Hnrnpk	A	G	13: 58,394,153	F339L	probably benign	Het
Iqgap3	A	G	3: 88,098,893	D537G	probably benign	Het
Kars	C	T	8: 112,008,481		probably null	Het
Kpna7	G	T	5: 144,992,844	N390K	probably damaging	Het
Lingo4	A	G	3: 94,402,850	E365G	probably damaging	Het
Liph	T	C	16: 21,984,268	D17G	probably benign	Het
Lmbrd1	C	A	1: 24,711,545	N166K	probably benign	Het
Nup155	T	C	15: 8,109,575	S44P	probably damaging	Het
Olfr1245	A	T	2: 89,575,194	C177*	probably null	Het
Olfr1441	A	G	19: 12,422,610	I100M	probably benign	Het
Olfr164	A	G	16: 19,286,557	M62T	probably damaging	Het
Pcdhga6	T	C	18: 37,708,271	V348A	probably benign	Het
Phc3	G	A	3: 30,937,049	Q295*	probably null	Het
Phyh	A	G	2: 4,927,490	E129G	probably damaging	Het
Polb	A	G	8: 22,647,447	S96P	probably damaging	Het
Ppp1r9a	A	T	6: 5,158,113	K1174*	probably null	Het
Ppp1r9b	C	T	11: 94,991,836	R97W	probably damaging	Het
Pttg1ip	T	C	10: 77,582,508		probably null	Het
Pygm	G	A	19: 6,397,937		probably null	Het
Rgs20	GGAGAGAG	GGAGAG	1: 5,020,883		probably null	Het
Rlf	T	C	4: 121,170,766	H111R	probably damaging	Het
Rmdn3	A	G	2: 119,139,350		probably null	Het
Ror2	T	A	13: 53,111,311	T570S	probably damaging	Het
Sel1l3	A	C	5: 53,155,719	I542R	possibly damaging	Het
Serpinb3d	A	G	1: 107,078,507	F284L	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc38a2	A	G	15: 96,692,516		probably null	Het
Tet2	T	C	3: 133,480,326	S1117G	probably benign	Het
Trav15-1-dv6-1	C	T	14: 53,559,957	A21V	probably damaging	Het
Tsr3	G	T	17: 25,241,861	D234Y	probably null	Het
Vmn1r220	A	T	13: 23,183,914	L204H	probably damaging	Het
Vmn1r3	A	T	4: 3,185,017	S97T	probably damaging	Het
Zfp599	A	G	9: 22,249,990	F293S	probably damaging	Het
Zfp983	A	G	17: 21,659,019	Y46C	probably damaging	Het

Other mutations in Krt36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Krt36	APN	11	100102948	missense	probably damaging	0.98
IGL01737:Krt36	APN	11	100104120	missense	possibly damaging	0.62
IGL02388:Krt36	APN	11	100105164	nonsense	probably null
IGL02985:Krt36	APN	11	100103179	missense	probably benign	0.32
R0393:Krt36	UTSW	11	100104114	missense	possibly damaging	0.91
R0617:Krt36	UTSW	11	100102275	missense	probably damaging	1.00
R0930:Krt36	UTSW	11	100103399	missense	probably damaging	1.00
R1166:Krt36	UTSW	11	100102828	missense	probably benign	0.00
R1201:Krt36	UTSW	11	100104057	missense	probably benign	0.22
R1587:Krt36	UTSW	11	100102302	missense	probably damaging	1.00
R1750:Krt36	UTSW	11	100104058	missense	probably benign	0.00
R1826:Krt36	UTSW	11	100103030	splice site	probably benign
R1846:Krt36	UTSW	11	100105548	missense	probably damaging	1.00
R2208:Krt36	UTSW	11	100102939	missense	probably damaging	0.96
R4303:Krt36	UTSW	11	100103413	missense	possibly damaging	0.59
R5140:Krt36	UTSW	11	100103502	missense	probably damaging	1.00
R5719:Krt36	UTSW	11	100104161	missense	possibly damaging	0.95
R5944:Krt36	UTSW	11	100105313	missense	probably benign
R6271:Krt36	UTSW	11	100104472	nonsense	probably null
R6809:Krt36	UTSW	11	100105509	missense	probably benign	0.00
R6856:Krt36	UTSW	11	100103390	missense	probably damaging	1.00
R7153:Krt36	UTSW	11	100105146	nonsense	probably null
R7602:Krt36	UTSW	11	100102960	missense	probably benign	0.00
R7822:Krt36	UTSW	11	100104140	missense	possibly damaging	0.86
R7894:Krt36	UTSW	11	100105235	missense	probably damaging	1.00
R8234:Krt36	UTSW	11	100104201	missense	probably damaging	1.00
R8480:Krt36	UTSW	11	100102809	missense	possibly damaging	0.95
R8904:Krt36	UTSW	11	100105347	missense	probably benign	0.00
R8969:Krt36	UTSW	11	100102303	missense	probably damaging	0.98
R8987:Krt36	UTSW	11	100103546	missense	possibly damaging	0.74
R9297:Krt36	UTSW	11	100103445	missense	probably damaging	1.00
R9314:Krt36	UTSW	11	100103401	nonsense	probably null
R9387:Krt36	UTSW	11	100104080	missense	probably damaging	1.00
R9585:Krt36	UTSW	11	100104066	missense	probably damaging	1.00
Z1088:Krt36	UTSW	11	100104189	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCTGGTGGCTGCTCACATTG -3'
(R):5'- AAGCCCATCTTTGGCCATG -3'

Sequencing Primer
(F):5'- CTGCTCACATTGCCCGG -3'
(R):5'- AAGCCCATCTTTGGCCATGTTTTG -3'

Posted On

2018-02-27