Incidental Mutation 'R6188:Ror2'
ID502327
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53111311 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 570 (T570S)
Ref Sequence ENSEMBL: ENSMUSP00000123362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect probably damaging
Transcript: ENSMUST00000021918
AA Change: T582S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: T582S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130235
AA Change: T570S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: T570S

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R8684:Ror2 UTSW 13 53110266 missense possibly damaging 0.90
R8834:Ror2 UTSW 13 53110302 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CGGAGTATACCTCACGGAAGAG -3'
(R):5'- GCCATCAAGACGCTGAAAG -3'

Sequencing Primer
(F):5'- AGGCCCAAGTCTGAGATCCTC -3'
(R):5'- GAGTTCCGGCAAGAGGC -3'
Posted On2018-02-27