Incidental Mutation 'R6188:Epb41l4a'
ID502345
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33832665 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 370 (I370L)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably benign
Transcript: ENSMUST00000025234
AA Change: I370L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: I370L

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGCCCCTAGTTTAAAGTGCTAATC -3'
(R):5'- ATTTATGGAGACTAGGGACTTGGAG -3'

Sequencing Primer
(F):5'- AGTGCTAATCAATTTACCAAAGGG -3'
(R):5'- CACAAATACCTGCCATTACGTTTGG -3'
Posted On2018-02-27