Incidental Mutation 'R6188:Cep120'
ID502347
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Namecentrosomal protein 120
SynonymsCcdc100
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location53681724-53744547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53724457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 312 (D312G)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
Predicted Effect probably benign
Transcript: ENSMUST00000049811
AA Change: D312G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: D312G

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53685961 missense probably benign 0.24
IGL01774:Cep120 APN 18 53706830 missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53714767 missense probably benign 0.01
IGL01906:Cep120 APN 18 53714912 missense probably benign
IGL01941:Cep120 APN 18 53723148 missense probably benign 0.00
IGL02952:Cep120 APN 18 53683228 utr 3 prime probably benign
IGL03248:Cep120 APN 18 53735772 missense probably benign 0.04
IGL03379:Cep120 APN 18 53709136 missense probably benign
R0019:Cep120 UTSW 18 53709047 splice site probably benign
R0039:Cep120 UTSW 18 53685961 missense probably benign 0.24
R0763:Cep120 UTSW 18 53721737 missense probably benign 0.00
R1015:Cep120 UTSW 18 53703121 critical splice donor site probably null
R1340:Cep120 UTSW 18 53724391 missense probably damaging 1.00
R1507:Cep120 UTSW 18 53697657 missense probably damaging 0.99
R1649:Cep120 UTSW 18 53724576 missense probably damaging 1.00
R1727:Cep120 UTSW 18 53727729 missense probably benign 0.01
R1739:Cep120 UTSW 18 53719214 critical splice donor site probably null
R1873:Cep120 UTSW 18 53738488 missense probably damaging 0.98
R1913:Cep120 UTSW 18 53723286 missense probably benign 0.26
R1968:Cep120 UTSW 18 53723241 missense probably benign 0.42
R1995:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2042:Cep120 UTSW 18 53735742 missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53719312 missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2215:Cep120 UTSW 18 53727635 missense probably damaging 1.00
R2697:Cep120 UTSW 18 53740125 missense probably benign 0.00
R3813:Cep120 UTSW 18 53740212 splice site probably benign
R4012:Cep120 UTSW 18 53738582 missense probably damaging 0.99
R4368:Cep120 UTSW 18 53685885 splice site probably null
R4615:Cep120 UTSW 18 53714841 missense probably damaging 1.00
R4772:Cep120 UTSW 18 53718489 missense probably damaging 1.00
R4780:Cep120 UTSW 18 53724536 missense probably benign 0.12
R5195:Cep120 UTSW 18 53721698 missense probably damaging 1.00
R5991:Cep120 UTSW 18 53721798 missense probably benign
R6156:Cep120 UTSW 18 53703223 missense probably benign 0.00
R6688:Cep120 UTSW 18 53724536 missense probably benign 0.12
R6961:Cep120 UTSW 18 53703205 nonsense probably null
R7143:Cep120 UTSW 18 53683385 missense probably benign 0.00
R7282:Cep120 UTSW 18 53740089 missense probably damaging 1.00
R7813:Cep120 UTSW 18 53738506 missense probably damaging 1.00
R7818:Cep120 UTSW 18 53723103 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGGGAATGCTACAAAGATTC -3'
(R):5'- CTGTGCTTAATTAATGAGACAGTGG -3'

Sequencing Primer
(F):5'- GATTCAACGCTTGTCATCACGAG -3'
(R):5'- AGAGGTTCTGAGTTCAATTCCCAGC -3'
Posted On2018-02-27