Mutagenetix > Incidental Mutation

Incidental Mutation 'R6189:Unc80'

502350

Institutional Source

Beutler Lab

Gene Symbol

Unc80

Ensembl Gene

ENSMUSG00000055567

Gene Name

unc-80, NALCN activator

Synonyms

C030018G13Rik, C230061B10Rik

MMRRC Submission

044329-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.915) question?

Stock #

R6189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66468367-66699148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66677471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 2917 (V2917I)

Ref Sequence

ENSEMBL: ENSMUSP00000053692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000061620
AA Change: V2917I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: V2917I

Domain	Start	End	E-Value	Type
Pfam:UNC80	16	236	2.2e-94	PFAM
low complexity region	372	385	N/A	INTRINSIC
low complexity region	493	502	N/A	INTRINSIC
low complexity region	693	711	N/A	INTRINSIC
low complexity region	723	738	N/A	INTRINSIC
low complexity region	739	769	N/A	INTRINSIC
low complexity region	1038	1055	N/A	INTRINSIC
low complexity region	1067	1084	N/A	INTRINSIC
low complexity region	1309	1328	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1676	1681	N/A	INTRINSIC
low complexity region	1842	1848	N/A	INTRINSIC
low complexity region	1854	1868	N/A	INTRINSIC
low complexity region	2461	2480	N/A	INTRINSIC
low complexity region	2726	2740	N/A	INTRINSIC
low complexity region	3121	3144	N/A	INTRINSIC
low complexity region	3245	3254	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152844

SMART Domains

Protein: ENSMUSP00000117070
Gene: ENSMUSG00000055567

Domain	Start	End	E-Value	Type
low complexity region	76	99	N/A	INTRINSIC
low complexity region	200	209	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187179

Predicted Effect

unknown
Transcript: ENSMUST00000212557
AA Change: V2849I

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	G	17: 48,167,054		probably benign	Het
Abca8a	T	C	11: 110,030,884	D1448G	probably damaging	Het
Actn2	C	T	13: 12,276,440	D693N	probably damaging	Het
Adam3	A	C	8: 24,711,336	I267R	probably benign	Het
Akap2	A	G	4: 57,855,928	E419G	probably benign	Het
Aldh1l2	A	G	10: 83,508,013		probably null	Het
C4bp	T	C	1: 130,636,819	Y376C	probably damaging	Het
Cacna1h	A	G	17: 25,397,844	W101R	probably damaging	Het
Ccdc84	G	A	9: 44,410,321	R328C	probably benign	Het
Ccdc97	T	A	7: 25,716,098	T47S	probably benign	Het
Cnot6l	G	A	5: 96,098,277	T171I	probably benign	Het
Cntnap2	T	A	6: 47,271,298	S1213T	probably damaging	Het
Cxcl10	A	T	5: 92,348,113	L55Q	probably benign	Het
Cyp1a1	T	C	9: 57,700,683	V198A	probably damaging	Het
Dclre1b	A	G	3: 103,803,533	V354A	probably damaging	Het
Dmxl1	C	T	18: 49,893,335	H1837Y	probably benign	Het
Dnajc13	G	C	9: 104,213,886	D665E	probably benign	Het
Dnmbp	T	C	19: 43,890,309	T108A	probably benign	Het
Dnmbp	T	A	19: 43,901,511	T606S	probably benign	Het
Dok5	T	A	2: 170,800,851	I23N	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epha5	A	T	5: 84,237,540	F311I	probably damaging	Het
Erbb4	T	A	1: 68,043,916	M1059L	probably benign	Het
Fbxo40	A	G	16: 36,966,164	I681T	probably benign	Het
Flg2	T	A	3: 93,220,074	C2098S	unknown	Het
Gm10471	A	G	5: 26,085,693	I160T	probably benign	Het
Gm11397	A	T	13: 33,404,444	E337D	probably benign	Het
Gpr87	T	A	3: 59,179,229	D285V	probably damaging	Het
Hrh1	T	A	6: 114,479,998	V80D	probably damaging	Het
Hunk	G	A	16: 90,487,881	R351K	probably benign	Het
Ifna12	A	G	4: 88,603,011	W100R	probably damaging	Het
Ift57	G	A	16: 49,763,813	G310S	probably damaging	Het
Igf1r	T	A	7: 68,207,336	Y1015*	probably null	Het
Igkv14-130	T	C	6: 67,791,448	I96T	probably damaging	Het
Il34	C	T	8: 110,742,718	S155N	probably benign	Het
Itga7	T	C	10: 128,950,403	S938P	possibly damaging	Het
Itgam	A	G	7: 128,112,504	M764V	probably benign	Het
Lao1	T	A	4: 118,967,880	M299K	probably benign	Het
Lnpep	A	T	17: 17,566,739	S533T	possibly damaging	Het
Lrp4	T	C	2: 91,475,234	V283A	possibly damaging	Het
Magi3	G	T	3: 104,050,865	H635N	probably damaging	Het
Mecr	A	T	4: 131,865,254		probably null	Het
Mgrn1	T	C	16: 4,910,810		probably null	Het
Micalcl	A	C	7: 112,412,880	N646H	probably damaging	Het
Mymk	C	T	2: 27,067,365	V39I	possibly damaging	Het
Nav3	T	C	10: 109,720,019	S1684G	probably damaging	Het
Ntn5	A	T	7: 45,693,220	D330V	probably benign	Het
Nupl2	G	T	5: 24,175,454	G149V	probably damaging	Het
Nutm2	T	A	13: 50,469,738	V157D	possibly damaging	Het
Obscn	T	C	11: 59,069,934	I3460V	probably benign	Het
Olfr1037	A	T	2: 86,084,913	M288K	possibly damaging	Het
Pcdh15	C	T	10: 74,342,651	A580V	probably null	Het
Pcdhb10	T	A	18: 37,412,403	H177Q	probably damaging	Het
Pitx2	T	C	3: 129,218,469	Y130H	probably damaging	Het
Pmch	G	T	10: 88,091,386		probably null	Het
Pofut2	T	A	10: 77,268,586	I399N	probably damaging	Het
Prr36	C	A	8: 4,214,177		probably benign	Het
Ptprq	C	A	10: 107,517,887	C2256F	probably damaging	Het
Rassf5	G	A	1: 131,244,979	A51V	probably damaging	Het
Retnla	A	G	16: 48,842,895	I54V	probably benign	Het
Rimbp2	A	G	5: 128,803,897	L142P	probably benign	Het
Ripk1	A	G	13: 34,032,501	T564A	probably benign	Het
Robo4	G	A	9: 37,403,533	E228K	probably benign	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Homo
Rusc1	A	T	3: 89,089,012	L132Q	probably damaging	Het
Setd1a	T	C	7: 127,778,283		probably null	Het
Slc38a6	A	T	12: 73,310,196	K122M	probably damaging	Het
Susd5	A	T	9: 114,095,658	D203V	probably damaging	Het
Trip4	G	A	9: 65,879,152	R110*	probably null	Het
Tuba4a	T	A	1: 75,216,874	I95F	probably benign	Het
Ube2q2	T	A	9: 55,162,983	S70T	probably benign	Het
Umodl1	A	G	17: 30,996,282	I1027V	possibly damaging	Het
Vmn1r70	T	A	7: 10,633,671	C29S	probably benign	Het
Vmn2r94	A	T	17: 18,257,734	D138E	probably benign	Het
Wee2	C	T	6: 40,449,683	H129Y	probably damaging	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp872	A	T	9: 22,197,131	D42V	probably benign	Het
Zic5	T	G	14: 122,464,974	D115A	unknown	Het

Other mutations in Unc80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Unc80	APN	1	66654395	missense	possibly damaging	0.53
IGL00340:Unc80	APN	1	66606459	missense	possibly damaging	0.73
IGL00783:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00784:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00935:Unc80	APN	1	66627266	missense	possibly damaging	0.53
IGL01094:Unc80	APN	1	66695433	missense	possibly damaging	0.90
IGL01466:Unc80	APN	1	66622486	missense	probably benign	0.33
IGL01577:Unc80	APN	1	66529968	splice site	probably null
IGL01626:Unc80	APN	1	66551054	critical splice donor site	probably null
IGL01640:Unc80	APN	1	66679585	missense	probably benign	0.33
IGL01775:Unc80	APN	1	66601056	missense	possibly damaging	0.94
IGL01960:Unc80	APN	1	66608500	splice site	probably benign
IGL01991:Unc80	APN	1	66469509	nonsense	probably null
IGL02022:Unc80	APN	1	66626516	missense	possibly damaging	0.53
IGL02073:Unc80	APN	1	66612227	missense	possibly damaging	0.85
IGL02077:Unc80	APN	1	66525716	missense	possibly damaging	0.77
IGL02197:Unc80	APN	1	66530065	missense	probably benign	0.39
IGL02198:Unc80	APN	1	66529986	missense	possibly damaging	0.88
IGL02228:Unc80	APN	1	66608428	missense	possibly damaging	0.72
IGL02327:Unc80	APN	1	66641673	missense	probably benign	0.33
IGL02447:Unc80	APN	1	66503544	missense	possibly damaging	0.86
IGL02489:Unc80	APN	1	66525701	missense	probably benign	0.07
IGL02546:Unc80	APN	1	66554953	missense	possibly damaging	0.83
IGL02629:Unc80	APN	1	66483317	missense	possibly damaging	0.46
IGL02631:Unc80	APN	1	66530063	missense	probably damaging	0.98
IGL02839:Unc80	APN	1	66671675	missense	possibly damaging	0.53
IGL02960:Unc80	APN	1	66678058	splice site	probably benign
IGL02974:Unc80	APN	1	66525658	missense	possibly damaging	0.95
IGL03060:Unc80	APN	1	66637010	missense	possibly damaging	0.96
IGL03062:Unc80	APN	1	66509489	missense	probably damaging	0.96
IGL03074:Unc80	APN	1	66671718	splice site	probably benign
IGL03086:Unc80	APN	1	66509474	missense	probably damaging	0.99
IGL03105:Unc80	APN	1	66472099	missense	probably damaging	0.96
IGL03107:Unc80	APN	1	66631454	missense	probably damaging	0.98
IGL03158:Unc80	APN	1	66641674	missense	probably benign	0.33
IGL03220:Unc80	APN	1	66504938	missense	probably damaging	0.99
IGL03271:Unc80	APN	1	66695603	unclassified	probably benign
IGL03332:Unc80	APN	1	66503631	missense	probably damaging	1.00
IGL03347:Unc80	APN	1	66695466	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0026:Unc80	UTSW	1	66521584	missense	probably benign	0.27
R0055:Unc80	UTSW	1	66506623	splice site	probably benign
R0149:Unc80	UTSW	1	66521601	missense	possibly damaging	0.82
R0325:Unc80	UTSW	1	66510881	missense	probably damaging	1.00
R0329:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0330:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0355:Unc80	UTSW	1	66549856	missense	possibly damaging	0.77
R0412:Unc80	UTSW	1	66550937	splice site	probably benign
R0422:Unc80	UTSW	1	66483338	missense	probably damaging	1.00
R0477:Unc80	UTSW	1	66570001	missense	probably damaging	0.99
R0507:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0513:Unc80	UTSW	1	66622474	missense	possibly damaging	0.73
R0553:Unc80	UTSW	1	66506669	missense	probably damaging	0.97
R0626:Unc80	UTSW	1	66608442	missense	probably benign	0.01
R0655:Unc80	UTSW	1	66503781	missense	probably damaging	0.98
R0742:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0755:Unc80	UTSW	1	66504923	missense	probably damaging	1.00
R0782:Unc80	UTSW	1	66622581	missense	possibly damaging	0.53
R0837:Unc80	UTSW	1	66648944	missense	possibly damaging	0.73
R0841:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R0893:Unc80	UTSW	1	66521486	missense	probably damaging	0.97
R0900:Unc80	UTSW	1	66671598	missense	probably benign	0.33
R0924:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0930:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0989:Unc80	UTSW	1	66646440	missense	possibly damaging	0.53
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1224:Unc80	UTSW	1	66471980	missense	probably damaging	1.00
R1240:Unc80	UTSW	1	66635902	missense	possibly damaging	0.85
R1245:Unc80	UTSW	1	66555095	missense	possibly damaging	0.94
R1467:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1473:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1500:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1556:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1562:Unc80	UTSW	1	66637957	missense	probably damaging	1.00
R1655:Unc80	UTSW	1	66672756	missense	possibly damaging	0.86
R1674:Unc80	UTSW	1	66509308	missense	probably damaging	1.00
R1680:Unc80	UTSW	1	66503669	nonsense	probably null
R1739:Unc80	UTSW	1	66527892	missense	probably damaging	0.97
R1756:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1783:Unc80	UTSW	1	66683273	missense	probably benign	0.01
R1834:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1854:Unc80	UTSW	1	66631414	missense	possibly damaging	0.93
R1871:Unc80	UTSW	1	66510717	missense	possibly damaging	0.77
R1878:Unc80	UTSW	1	66509402	missense	probably damaging	0.96
R1883:Unc80	UTSW	1	66525770	missense	possibly damaging	0.89
R1912:Unc80	UTSW	1	66510625	missense	probably damaging	1.00
R1990:Unc80	UTSW	1	66692549	missense	probably damaging	0.97
R2007:Unc80	UTSW	1	66503776	missense	probably damaging	1.00
R2035:Unc80	UTSW	1	66606593	missense	probably damaging	0.98
R2056:Unc80	UTSW	1	66640552	missense	possibly damaging	0.72
R2060:Unc80	UTSW	1	66640595	missense	possibly damaging	0.53
R2074:Unc80	UTSW	1	66679744	critical splice donor site	probably null
R2088:Unc80	UTSW	1	66590227	missense	possibly damaging	0.77
R2089:Unc80	UTSW	1	66671715	splice site	probably benign
R2091:Unc80	UTSW	1	66671715	splice site	probably benign
R2139:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2169:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2175:Unc80	UTSW	1	66677355	missense	probably damaging	1.00
R2248:Unc80	UTSW	1	66623206	splice site	probably benign
R2255:Unc80	UTSW	1	66618258	missense	possibly damaging	0.53
R2308:Unc80	UTSW	1	66648997	missense	possibly damaging	0.53
R2484:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2507:Unc80	UTSW	1	66612107	missense	possibly damaging	0.53
R2512:Unc80	UTSW	1	66671608	missense	possibly damaging	0.70
R2878:Unc80	UTSW	1	66671576	critical splice acceptor site	probably benign
R3040:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3104:Unc80	UTSW	1	66623291	missense	probably benign	0.33
R3402:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3403:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3413:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3426:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3427:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3428:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3904:Unc80	UTSW	1	66639296	nonsense	probably null
R3916:Unc80	UTSW	1	66677495	missense	probably benign	0.11
R3950:Unc80	UTSW	1	66622570	missense	possibly damaging	0.53
R4642:Unc80	UTSW	1	66671714	splice site	probably null
R4646:Unc80	UTSW	1	66669235	missense	probably benign	0.03
R4655:Unc80	UTSW	1	66671662	missense	probably benign	0.18
R4662:Unc80	UTSW	1	66646436	missense	probably benign	0.01
R4720:Unc80	UTSW	1	66510792	missense	possibly damaging	0.92
R4736:Unc80	UTSW	1	66649672	critical splice acceptor site	probably null
R4795:Unc80	UTSW	1	66527941	missense	probably damaging	0.97
R4888:Unc80	UTSW	1	66644447	missense	probably damaging	0.98
R4917:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4918:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4983:Unc80	UTSW	1	66674732	splice site	probably null
R5051:Unc80	UTSW	1	66509477	missense	probably damaging	0.96
R5111:Unc80	UTSW	1	66527995	missense	possibly damaging	0.66
R5122:Unc80	UTSW	1	66679590	missense	possibly damaging	0.53
R5260:Unc80	UTSW	1	66646587	missense	possibly damaging	0.53
R5351:Unc80	UTSW	1	66606513	missense	possibly damaging	0.73
R5387:Unc80	UTSW	1	66530021	missense	possibly damaging	0.77
R5437:Unc80	UTSW	1	66654578	missense	possibly damaging	0.96
R5525:Unc80	UTSW	1	66606614	missense	possibly damaging	0.72
R5621:Unc80	UTSW	1	66638043	missense	possibly damaging	0.53
R5690:Unc80	UTSW	1	66640572	missense	probably benign	0.08
R5762:Unc80	UTSW	1	66693796	missense	possibly damaging	0.82
R5956:Unc80	UTSW	1	66527964	missense	probably damaging	0.97
R6005:Unc80	UTSW	1	66627257	missense	possibly damaging	0.53
R6025:Unc80	UTSW	1	66695568	missense	possibly damaging	0.90
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6117:Unc80	UTSW	1	66675067	missense	possibly damaging	0.72
R6156:Unc80	UTSW	1	66612250	missense	probably benign	0.01
R6157:Unc80	UTSW	1	66654029	nonsense	probably null
R6291:Unc80	UTSW	1	66521597	missense	possibly damaging	0.82
R6367:Unc80	UTSW	1	66672766	missense	probably benign	0.33
R6598:Unc80	UTSW	1	66468540	critical splice donor site	probably null
R6724:Unc80	UTSW	1	66683191	missense	possibly damaging	0.90
R6763:Unc80	UTSW	1	66521477	missense	probably benign	0.00
R6773:Unc80	UTSW	1	66651543	missense	probably benign	0.33
R6883:Unc80	UTSW	1	66646404	missense	probably benign	0.33
R6951:Unc80	UTSW	1	66648511	missense	possibly damaging	0.53
R6965:Unc80	UTSW	1	66646566	missense	probably benign	0.33
R6993:Unc80	UTSW	1	66549793	missense	possibly damaging	0.60
R7041:Unc80	UTSW	1	66503593	missense	probably benign	0.00
R7050:Unc80	UTSW	1	66550908	splice site	probably null
R7067:Unc80	UTSW	1	66646572	missense	possibly damaging	0.86
R7080:Unc80	UTSW	1	66646521	missense	possibly damaging	0.53
R7193:Unc80	UTSW	1	66549784	missense	possibly damaging	0.60
R7197:Unc80	UTSW	1	66521566	nonsense	probably null
R7278:Unc80	UTSW	1	66552209	missense	possibly damaging	0.82
R7290:Unc80	UTSW	1	66601197	missense	probably damaging	0.97
R7391:Unc80	UTSW	1	66695528	missense	probably benign	0.18
R7401:Unc80	UTSW	1	66646415	missense	possibly damaging	0.96
R7470:Unc80	UTSW	1	66622462	missense	probably benign	0.02
R7573:Unc80	UTSW	1	66521537	missense	probably damaging	1.00
R7637:Unc80	UTSW	1	66672684	missense	possibly damaging	0.86
R7678:Unc80	UTSW	1	66649722	missense	probably benign	0.33
R7697:Unc80	UTSW	1	66637945	missense	possibly damaging	0.93
R7746:Unc80	UTSW	1	66677385	missense	probably benign	0.33
R7768:Unc80	UTSW	1	66510595	missense	possibly damaging	0.56
R7796:Unc80	UTSW	1	66503714	missense	probably benign
R7855:Unc80	UTSW	1	66483349	missense	possibly damaging	0.78
R7878:Unc80	UTSW	1	66601141	missense	possibly damaging	0.88
R7879:Unc80	UTSW	1	66510707	missense	probably benign	0.00
R8024:Unc80	UTSW	1	66606644	missense	possibly damaging	0.86
R8026:Unc80	UTSW	1	66483304	missense	possibly damaging	0.92
R8115:Unc80	UTSW	1	66648913	missense	probably benign	0.00
R8135:Unc80	UTSW	1	66509287	missense	possibly damaging	0.49
R8170:Unc80	UTSW	1	66651533	missense	probably benign	0.33
R8239:Unc80	UTSW	1	66654019	missense	probably benign
R8249:Unc80	UTSW	1	66619491	missense	probably benign	0.01
R8275:Unc80	UTSW	1	66640614	nonsense	probably null
R8288:Unc80	UTSW	1	66473350	missense	probably benign	0.07
R8341:Unc80	UTSW	1	66649033	missense	possibly damaging	0.73
R8356:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8433:Unc80	UTSW	1	66638028	nonsense	probably null
R8456:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8464:Unc80	UTSW	1	66473264	missense	probably damaging	1.00
R8483:Unc80	UTSW	1	66693710	missense	possibly damaging	0.83
R8509:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8686:Unc80	UTSW	1	66612268	missense	possibly damaging	0.53
R8701:Unc80	UTSW	1	66638032	missense	possibly damaging	0.85
R8729:Unc80	UTSW	1	66608490	missense	probably benign	0.01
R8755:Unc80	UTSW	1	66612131	missense	possibly damaging	0.53
R8771:Unc80	UTSW	1	66646395	missense	possibly damaging	0.85
R8866:Unc80	UTSW	1	66590229	missense	probably benign	0.05
R8877:Unc80	UTSW	1	66527985	missense	possibly damaging	0.89
R8942:Unc80	UTSW	1	66473309	missense	possibly damaging	0.94
R8976:Unc80	UTSW	1	66472010	missense	possibly damaging	0.87
R9063:Unc80	UTSW	1	66606657	critical splice donor site	probably null
R9095:Unc80	UTSW	1	66506753	missense	probably damaging	1.00
R9125:Unc80	UTSW	1	66679581	missense	probably benign	0.18
R9130:Unc80	UTSW	1	66638085	missense	possibly damaging	0.85
R9165:Unc80	UTSW	1	66549841	missense	probably null	0.95
R9220:Unc80	UTSW	1	66507375	missense	probably damaging	1.00
R9262:Unc80	UTSW	1	66555252	intron	probably benign
R9334:Unc80	UTSW	1	66649760	missense	possibly damaging	0.73
R9374:Unc80	UTSW	1	66590301	missense	possibly damaging	0.95
R9387:Unc80	UTSW	1	66549938	critical splice donor site	probably null
R9415:Unc80	UTSW	1	66510905	missense
R9427:Unc80	UTSW	1	66554999	missense	probably damaging	1.00
R9436:Unc80	UTSW	1	66693805	critical splice donor site	probably null
R9454:Unc80	UTSW	1	66695590	missense	possibly damaging	0.53
R9522:Unc80	UTSW	1	66638062	missense	possibly damaging	0.73
R9539:Unc80	UTSW	1	66570004	critical splice donor site	probably null
R9552:Unc80	UTSW	1	66678123	missense	possibly damaging	0.85
R9667:Unc80	UTSW	1	66612128	missense	possibly damaging	0.86
R9720:Unc80	UTSW	1	66644326	missense	possibly damaging	0.53
R9749:Unc80	UTSW	1	66505020	missense	probably damaging	0.99
R9789:Unc80	UTSW	1	66612212	missense	possibly damaging	0.53
X0019:Unc80	UTSW	1	66648382	missense	probably benign	0.33
X0021:Unc80	UTSW	1	66509266	critical splice acceptor site	probably null
X0024:Unc80	UTSW	1	66491046	missense	probably benign	0.21
X0062:Unc80	UTSW	1	66623259	missense	probably benign	0.02
X0066:Unc80	UTSW	1	66530757	missense	possibly damaging	0.77
Y4335:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4336:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4338:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Z1088:Unc80	UTSW	1	66646451	missense	possibly damaging	0.85
Z1176:Unc80	UTSW	1	66694409	missense	probably benign
Z1177:Unc80	UTSW	1	66646398	missense	possibly damaging	0.72
Z1177:Unc80	UTSW	1	66695339	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGTGGGCAGAGTTCCTCTAAG -3'
(R):5'- GCTGTTTTCTCACCGAACAC -3'

Sequencing Primer
(F):5'- AGAGTTCCTCTAAGGCCCAG -3'
(R):5'- CGGTATTAACAGCCCCTGC -3'

Posted On

2018-02-27