Incidental Mutation 'R6189:Olfr1037'
ID502356
Institutional Source Beutler Lab
Gene Symbol Olfr1037
Ensembl Gene ENSMUSG00000075205
Gene Nameolfactory receptor 1037
SynonymsMOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775
MMRRC Submission 044329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6189 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86084671-86087385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86084913 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 288 (M288K)
Ref Sequence ENSEMBL: ENSMUSP00000150319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099911
AA Change: M288K

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: M288K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213333
AA Change: M288K

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216020
AA Change: M288K

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216886
AA Change: M288K

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,167,054 probably benign Het
Abca8a T C 11: 110,030,884 D1448G probably damaging Het
Actn2 C T 13: 12,276,440 D693N probably damaging Het
Adam3 A C 8: 24,711,336 I267R probably benign Het
Akap2 A G 4: 57,855,928 E419G probably benign Het
Aldh1l2 A G 10: 83,508,013 probably null Het
C4bp T C 1: 130,636,819 Y376C probably damaging Het
Cacna1h A G 17: 25,397,844 W101R probably damaging Het
Ccdc84 G A 9: 44,410,321 R328C probably benign Het
Ccdc97 T A 7: 25,716,098 T47S probably benign Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cntnap2 T A 6: 47,271,298 S1213T probably damaging Het
Cxcl10 A T 5: 92,348,113 L55Q probably benign Het
Cyp1a1 T C 9: 57,700,683 V198A probably damaging Het
Dclre1b A G 3: 103,803,533 V354A probably damaging Het
Dmxl1 C T 18: 49,893,335 H1837Y probably benign Het
Dnajc13 G C 9: 104,213,886 D665E probably benign Het
Dnmbp T C 19: 43,890,309 T108A probably benign Het
Dnmbp T A 19: 43,901,511 T606S probably benign Het
Dok5 T A 2: 170,800,851 I23N probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha5 A T 5: 84,237,540 F311I probably damaging Het
Erbb4 T A 1: 68,043,916 M1059L probably benign Het
Fbxo40 A G 16: 36,966,164 I681T probably benign Het
Flg2 T A 3: 93,220,074 C2098S unknown Het
Gm10471 A G 5: 26,085,693 I160T probably benign Het
Gm11397 A T 13: 33,404,444 E337D probably benign Het
Gpr87 T A 3: 59,179,229 D285V probably damaging Het
Hrh1 T A 6: 114,479,998 V80D probably damaging Het
Hunk G A 16: 90,487,881 R351K probably benign Het
Ifna12 A G 4: 88,603,011 W100R probably damaging Het
Ift57 G A 16: 49,763,813 G310S probably damaging Het
Igf1r T A 7: 68,207,336 Y1015* probably null Het
Igkv14-130 T C 6: 67,791,448 I96T probably damaging Het
Il34 C T 8: 110,742,718 S155N probably benign Het
Itga7 T C 10: 128,950,403 S938P possibly damaging Het
Itgam A G 7: 128,112,504 M764V probably benign Het
Lao1 T A 4: 118,967,880 M299K probably benign Het
Lnpep A T 17: 17,566,739 S533T possibly damaging Het
Lrp4 T C 2: 91,475,234 V283A possibly damaging Het
Magi3 G T 3: 104,050,865 H635N probably damaging Het
Mecr A T 4: 131,865,254 probably null Het
Mgrn1 T C 16: 4,910,810 probably null Het
Micalcl A C 7: 112,412,880 N646H probably damaging Het
Mymk C T 2: 27,067,365 V39I possibly damaging Het
Nav3 T C 10: 109,720,019 S1684G probably damaging Het
Ntn5 A T 7: 45,693,220 D330V probably benign Het
Nupl2 G T 5: 24,175,454 G149V probably damaging Het
Nutm2 T A 13: 50,469,738 V157D possibly damaging Het
Obscn T C 11: 59,069,934 I3460V probably benign Het
Pcdh15 C T 10: 74,342,651 A580V probably null Het
Pcdhb10 T A 18: 37,412,403 H177Q probably damaging Het
Pitx2 T C 3: 129,218,469 Y130H probably damaging Het
Pmch G T 10: 88,091,386 probably null Het
Pofut2 T A 10: 77,268,586 I399N probably damaging Het
Prr36 C A 8: 4,214,177 probably benign Het
Ptprq C A 10: 107,517,887 C2256F probably damaging Het
Rassf5 G A 1: 131,244,979 A51V probably damaging Het
Retnla A G 16: 48,842,895 I54V probably benign Het
Rimbp2 A G 5: 128,803,897 L142P probably benign Het
Ripk1 A G 13: 34,032,501 T564A probably benign Het
Robo4 G A 9: 37,403,533 E228K probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Rusc1 A T 3: 89,089,012 L132Q probably damaging Het
Setd1a T C 7: 127,778,283 probably null Het
Slc38a6 A T 12: 73,310,196 K122M probably damaging Het
Susd5 A T 9: 114,095,658 D203V probably damaging Het
Trip4 G A 9: 65,879,152 R110* probably null Het
Tuba4a T A 1: 75,216,874 I95F probably benign Het
Ube2q2 T A 9: 55,162,983 S70T probably benign Het
Umodl1 A G 17: 30,996,282 I1027V possibly damaging Het
Unc80 G A 1: 66,677,471 V2917I probably benign Het
Vmn1r70 T A 7: 10,633,671 C29S probably benign Het
Vmn2r94 A T 17: 18,257,734 D138E probably benign Het
Wee2 C T 6: 40,449,683 H129Y probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp872 A T 9: 22,197,131 D42V probably benign Het
Zic5 T G 14: 122,464,974 D115A unknown Het
Other mutations in Olfr1037
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Olfr1037 APN 2 86085640 missense probably benign 0.05
IGL02534:Olfr1037 APN 2 86085369 missense probably damaging 1.00
IGL03204:Olfr1037 APN 2 86085671 nonsense probably null
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0666:Olfr1037 UTSW 2 86085213 missense probably benign 0.03
R0732:Olfr1037 UTSW 2 86085584 missense probably benign 0.00
R1167:Olfr1037 UTSW 2 86085291 missense probably benign 0.16
R1899:Olfr1037 UTSW 2 86085720 missense probably benign
R3082:Olfr1037 UTSW 2 86085709 missense probably benign
R3847:Olfr1037 UTSW 2 86085407 nonsense probably null
R3848:Olfr1037 UTSW 2 86085407 nonsense probably null
R4079:Olfr1037 UTSW 2 86085312 missense possibly damaging 0.67
R4193:Olfr1037 UTSW 2 86085700 missense probably benign 0.01
R4832:Olfr1037 UTSW 2 86084846 missense probably benign 0.00
R5244:Olfr1037 UTSW 2 86084956 missense probably damaging 1.00
R5643:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5644:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5974:Olfr1037 UTSW 2 86084881 missense probably benign
R6136:Olfr1037 UTSW 2 86084901 missense probably damaging 1.00
R6483:Olfr1037 UTSW 2 86085440 missense probably benign 0.00
R6569:Olfr1037 UTSW 2 86085505 missense possibly damaging 0.87
R6724:Olfr1037 UTSW 2 86085357 missense possibly damaging 0.81
R6867:Olfr1037 UTSW 2 86085738 missense possibly damaging 0.59
R7081:Olfr1037 UTSW 2 86085595 missense probably damaging 1.00
R7207:Olfr1037 UTSW 2 86084815 missense possibly damaging 0.93
R7436:Olfr1037 UTSW 2 86084907 missense probably damaging 1.00
X0062:Olfr1037 UTSW 2 86085114 missense probably damaging 1.00
Z1088:Olfr1037 UTSW 2 86084982 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTGTCTTGCTAGAGAACGC -3'
(R):5'- TGGCTGCTATCTTAAGAATCCAG -3'

Sequencing Primer
(F):5'- CGCTAGCATGCAAAACGTG -3'
(R):5'- TGCTATCTTAAGAATCCAGTCCACAG -3'
Posted On2018-02-27