Incidental Mutation 'R6189:Rimbp2'
ID502374
Institutional Source Beutler Lab
Gene Symbol Rimbp2
Ensembl Gene ENSMUSG00000029420
Gene NameRIMS binding protein 2
Synonyms
MMRRC Submission 044329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6189 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location128757791-128953486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128803897 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 142 (L142P)
Ref Sequence ENSEMBL: ENSMUSP00000143099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111346] [ENSMUST00000196085] [ENSMUST00000198941] [ENSMUST00000199537] [ENSMUST00000199737] [ENSMUST00000200470]
Predicted Effect probably benign
Transcript: ENSMUST00000111346
AA Change: L149P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106978
Gene: ENSMUSG00000029420
AA Change: L149P

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000196085
AA Change: L149P
SMART Domains Protein: ENSMUSP00000143725
Gene: ENSMUSG00000029420
AA Change: L149P

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1e-13 SMART
FN3 318 398 7.7e-4 SMART
FN3 412 484 1.7e-5 SMART
FN3 508 594 1.6e-4 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 699 720 N/A INTRINSIC
low complexity region 751 767 N/A INTRINSIC
SH3 803 867 3.2e-13 SMART
SH3 907 970 4.5e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198941
AA Change: L149P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142455
Gene: ENSMUSG00000029420
AA Change: L149P

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199537
AA Change: L142P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143276
Gene: ENSMUSG00000029420
AA Change: L142P

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 1.61e-11 SMART
FN3 311 391 1.52e-1 SMART
FN3 405 477 3.59e-3 SMART
FN3 501 587 3.08e-2 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 5.24e-11 SMART
SH3 975 1038 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199737
SMART Domains Protein: ENSMUSP00000142712
Gene: ENSMUSG00000029420

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200470
AA Change: L142P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143099
Gene: ENSMUSG00000029420
AA Change: L142P

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 9.8e-14 SMART
FN3 311 391 7.5e-4 SMART
FN3 405 477 1.7e-5 SMART
FN3 501 587 1.5e-4 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 3.2e-13 SMART
SH3 975 1038 4.4e-20 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Homozygous knockout results in a mild neurological phenotype with changes in the synaptic transmission and plasticity of hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,167,054 probably benign Het
Abca8a T C 11: 110,030,884 D1448G probably damaging Het
Actn2 C T 13: 12,276,440 D693N probably damaging Het
Adam3 A C 8: 24,711,336 I267R probably benign Het
Akap2 A G 4: 57,855,928 E419G probably benign Het
Aldh1l2 A G 10: 83,508,013 probably null Het
C4bp T C 1: 130,636,819 Y376C probably damaging Het
Cacna1h A G 17: 25,397,844 W101R probably damaging Het
Ccdc84 G A 9: 44,410,321 R328C probably benign Het
Ccdc97 T A 7: 25,716,098 T47S probably benign Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cntnap2 T A 6: 47,271,298 S1213T probably damaging Het
Cxcl10 A T 5: 92,348,113 L55Q probably benign Het
Cyp1a1 T C 9: 57,700,683 V198A probably damaging Het
Dclre1b A G 3: 103,803,533 V354A probably damaging Het
Dmxl1 C T 18: 49,893,335 H1837Y probably benign Het
Dnajc13 G C 9: 104,213,886 D665E probably benign Het
Dnmbp T C 19: 43,890,309 T108A probably benign Het
Dnmbp T A 19: 43,901,511 T606S probably benign Het
Dok5 T A 2: 170,800,851 I23N probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha5 A T 5: 84,237,540 F311I probably damaging Het
Erbb4 T A 1: 68,043,916 M1059L probably benign Het
Fbxo40 A G 16: 36,966,164 I681T probably benign Het
Flg2 T A 3: 93,220,074 C2098S unknown Het
Gm10471 A G 5: 26,085,693 I160T probably benign Het
Gm11397 A T 13: 33,404,444 E337D probably benign Het
Gpr87 T A 3: 59,179,229 D285V probably damaging Het
Hrh1 T A 6: 114,479,998 V80D probably damaging Het
Hunk G A 16: 90,487,881 R351K probably benign Het
Ifna12 A G 4: 88,603,011 W100R probably damaging Het
Ift57 G A 16: 49,763,813 G310S probably damaging Het
Igf1r T A 7: 68,207,336 Y1015* probably null Het
Igkv14-130 T C 6: 67,791,448 I96T probably damaging Het
Il34 C T 8: 110,742,718 S155N probably benign Het
Itga7 T C 10: 128,950,403 S938P possibly damaging Het
Itgam A G 7: 128,112,504 M764V probably benign Het
Lao1 T A 4: 118,967,880 M299K probably benign Het
Lnpep A T 17: 17,566,739 S533T possibly damaging Het
Lrp4 T C 2: 91,475,234 V283A possibly damaging Het
Magi3 G T 3: 104,050,865 H635N probably damaging Het
Mecr A T 4: 131,865,254 probably null Het
Mgrn1 T C 16: 4,910,810 probably null Het
Micalcl A C 7: 112,412,880 N646H probably damaging Het
Mymk C T 2: 27,067,365 V39I possibly damaging Het
Nav3 T C 10: 109,720,019 S1684G probably damaging Het
Ntn5 A T 7: 45,693,220 D330V probably benign Het
Nupl2 G T 5: 24,175,454 G149V probably damaging Het
Nutm2 T A 13: 50,469,738 V157D possibly damaging Het
Obscn T C 11: 59,069,934 I3460V probably benign Het
Olfr1037 A T 2: 86,084,913 M288K possibly damaging Het
Pcdh15 C T 10: 74,342,651 A580V probably null Het
Pcdhb10 T A 18: 37,412,403 H177Q probably damaging Het
Pitx2 T C 3: 129,218,469 Y130H probably damaging Het
Pmch G T 10: 88,091,386 probably null Het
Pofut2 T A 10: 77,268,586 I399N probably damaging Het
Prr36 C A 8: 4,214,177 probably benign Het
Ptprq C A 10: 107,517,887 C2256F probably damaging Het
Rassf5 G A 1: 131,244,979 A51V probably damaging Het
Retnla A G 16: 48,842,895 I54V probably benign Het
Ripk1 A G 13: 34,032,501 T564A probably benign Het
Robo4 G A 9: 37,403,533 E228K probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Rusc1 A T 3: 89,089,012 L132Q probably damaging Het
Setd1a T C 7: 127,778,283 probably null Het
Slc38a6 A T 12: 73,310,196 K122M probably damaging Het
Susd5 A T 9: 114,095,658 D203V probably damaging Het
Trip4 G A 9: 65,879,152 R110* probably null Het
Tuba4a T A 1: 75,216,874 I95F probably benign Het
Ube2q2 T A 9: 55,162,983 S70T probably benign Het
Umodl1 A G 17: 30,996,282 I1027V possibly damaging Het
Unc80 G A 1: 66,677,471 V2917I probably benign Het
Vmn1r70 T A 7: 10,633,671 C29S probably benign Het
Vmn2r94 A T 17: 18,257,734 D138E probably benign Het
Wee2 C T 6: 40,449,683 H129Y probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp872 A T 9: 22,197,131 D42V probably benign Het
Zic5 T G 14: 122,464,974 D115A unknown Het
Other mutations in Rimbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Rimbp2 APN 5 128806441 missense probably benign 0.00
IGL01321:Rimbp2 APN 5 128786752 missense probably benign 0.10
IGL01459:Rimbp2 APN 5 128788211 critical splice donor site probably null
IGL01743:Rimbp2 APN 5 128797848 splice site probably benign
IGL01975:Rimbp2 APN 5 128797648 missense probably benign 0.30
IGL02269:Rimbp2 APN 5 128774295 missense probably damaging 1.00
IGL02341:Rimbp2 APN 5 128800961 nonsense probably null
IGL02368:Rimbp2 APN 5 128788154 splice site probably null
IGL02392:Rimbp2 APN 5 128771797 missense probably benign 0.01
IGL03156:Rimbp2 APN 5 128771757 missense probably damaging 1.00
IGL02837:Rimbp2 UTSW 5 128797745 missense probably damaging 0.98
PIT4418001:Rimbp2 UTSW 5 128780361 missense probably benign 0.00
R0193:Rimbp2 UTSW 5 128788356 missense probably benign 0.12
R0376:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0377:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0661:Rimbp2 UTSW 5 128786710 missense probably benign 0.20
R1217:Rimbp2 UTSW 5 128788287 missense probably benign 0.04
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1551:Rimbp2 UTSW 5 128806359 missense probably damaging 0.97
R1883:Rimbp2 UTSW 5 128803934 missense possibly damaging 0.93
R1970:Rimbp2 UTSW 5 128797241 missense probably damaging 1.00
R2111:Rimbp2 UTSW 5 128773501 missense probably damaging 1.00
R2120:Rimbp2 UTSW 5 128788518 missense probably damaging 1.00
R2155:Rimbp2 UTSW 5 128788165 missense probably damaging 0.99
R2332:Rimbp2 UTSW 5 128789641 missense probably benign 0.42
R2370:Rimbp2 UTSW 5 128803844 missense probably damaging 0.99
R2402:Rimbp2 UTSW 5 128784888 missense probably damaging 1.00
R3710:Rimbp2 UTSW 5 128789731 missense probably benign 0.16
R3877:Rimbp2 UTSW 5 128773465 missense probably damaging 1.00
R3974:Rimbp2 UTSW 5 128797798 missense probably damaging 1.00
R4257:Rimbp2 UTSW 5 128774260 missense probably damaging 1.00
R4270:Rimbp2 UTSW 5 128819777 missense probably benign
R4271:Rimbp2 UTSW 5 128819777 missense probably benign
R4281:Rimbp2 UTSW 5 128788340 missense possibly damaging 0.82
R4934:Rimbp2 UTSW 5 128788515 missense probably benign 0.12
R5011:Rimbp2 UTSW 5 128803921 missense probably damaging 0.98
R5173:Rimbp2 UTSW 5 128797648 missense probably benign 0.30
R5288:Rimbp2 UTSW 5 128788592 missense probably benign 0.00
R5305:Rimbp2 UTSW 5 128797381 missense possibly damaging 0.69
R5554:Rimbp2 UTSW 5 128780342 missense probably damaging 0.98
R7023:Rimbp2 UTSW 5 128802783 critical splice donor site probably null
R7096:Rimbp2 UTSW 5 128774269 missense probably damaging 0.99
R7451:Rimbp2 UTSW 5 128788371 missense probably benign 0.00
R7789:Rimbp2 UTSW 5 128774335 missense probably damaging 0.99
R7793:Rimbp2 UTSW 5 128789695 missense possibly damaging 0.92
R7894:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
R7977:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGAGTCACTAAGGATGG -3'
(R):5'- TGTCTCAGATCACAGGTCACC -3'

Sequencing Primer
(F):5'- CTGAGTCACTAAGGATGGATGTG -3'
(R):5'- AGGCCCTCAGTACAGCCAG -3'
Posted On2018-02-27