Incidental Mutation 'R6189:Setd1a'
ID 502386
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 044329-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6189 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127776670-127800122 bp(+) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 127778283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000061587] [ENSMUST00000118865] [ENSMUST00000121504] [ENSMUST00000126761] [ENSMUST00000143951] [ENSMUST00000144406]
AlphaFold E9PYH6
Predicted Effect probably null
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061587
SMART Domains Protein: ENSMUSP00000050279
Gene: ENSMUSG00000043964

DomainStartEndE-ValueType
Pfam:Orai-1 46 271 1.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118865
SMART Domains Protein: ENSMUSP00000112382
Gene: ENSMUSG00000043964

DomainStartEndE-ValueType
Pfam:Orai-1 42 165 1.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121504
SMART Domains Protein: ENSMUSP00000113142
Gene: ENSMUSG00000043964

DomainStartEndE-ValueType
Pfam:Orai-1 42 94 1.3e-16 PFAM
low complexity region 125 133 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably null
Transcript: ENSMUST00000143951
Predicted Effect probably null
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,167,054 probably benign Het
Abca8a T C 11: 110,030,884 D1448G probably damaging Het
Actn2 C T 13: 12,276,440 D693N probably damaging Het
Adam3 A C 8: 24,711,336 I267R probably benign Het
Akap2 A G 4: 57,855,928 E419G probably benign Het
Aldh1l2 A G 10: 83,508,013 probably null Het
C4bp T C 1: 130,636,819 Y376C probably damaging Het
Cacna1h A G 17: 25,397,844 W101R probably damaging Het
Ccdc84 G A 9: 44,410,321 R328C probably benign Het
Ccdc97 T A 7: 25,716,098 T47S probably benign Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cntnap2 T A 6: 47,271,298 S1213T probably damaging Het
Cxcl10 A T 5: 92,348,113 L55Q probably benign Het
Cyp1a1 T C 9: 57,700,683 V198A probably damaging Het
Dclre1b A G 3: 103,803,533 V354A probably damaging Het
Dmxl1 C T 18: 49,893,335 H1837Y probably benign Het
Dnajc13 G C 9: 104,213,886 D665E probably benign Het
Dnmbp T C 19: 43,890,309 T108A probably benign Het
Dnmbp T A 19: 43,901,511 T606S probably benign Het
Dok5 T A 2: 170,800,851 I23N probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha5 A T 5: 84,237,540 F311I probably damaging Het
Erbb4 T A 1: 68,043,916 M1059L probably benign Het
Fbxo40 A G 16: 36,966,164 I681T probably benign Het
Flg2 T A 3: 93,220,074 C2098S unknown Het
Gm10471 A G 5: 26,085,693 I160T probably benign Het
Gm11397 A T 13: 33,404,444 E337D probably benign Het
Gpr87 T A 3: 59,179,229 D285V probably damaging Het
Hrh1 T A 6: 114,479,998 V80D probably damaging Het
Hunk G A 16: 90,487,881 R351K probably benign Het
Ifna12 A G 4: 88,603,011 W100R probably damaging Het
Ift57 G A 16: 49,763,813 G310S probably damaging Het
Igf1r T A 7: 68,207,336 Y1015* probably null Het
Igkv14-130 T C 6: 67,791,448 I96T probably damaging Het
Il34 C T 8: 110,742,718 S155N probably benign Het
Itga7 T C 10: 128,950,403 S938P possibly damaging Het
Itgam A G 7: 128,112,504 M764V probably benign Het
Lao1 T A 4: 118,967,880 M299K probably benign Het
Lnpep A T 17: 17,566,739 S533T possibly damaging Het
Lrp4 T C 2: 91,475,234 V283A possibly damaging Het
Magi3 G T 3: 104,050,865 H635N probably damaging Het
Mecr A T 4: 131,865,254 probably null Het
Mgrn1 T C 16: 4,910,810 probably null Het
Micalcl A C 7: 112,412,880 N646H probably damaging Het
Mymk C T 2: 27,067,365 V39I possibly damaging Het
Nav3 T C 10: 109,720,019 S1684G probably damaging Het
Ntn5 A T 7: 45,693,220 D330V probably benign Het
Nupl2 G T 5: 24,175,454 G149V probably damaging Het
Nutm2 T A 13: 50,469,738 V157D possibly damaging Het
Obscn T C 11: 59,069,934 I3460V probably benign Het
Olfr1037 A T 2: 86,084,913 M288K possibly damaging Het
Pcdh15 C T 10: 74,342,651 A580V probably null Het
Pcdhb10 T A 18: 37,412,403 H177Q probably damaging Het
Pitx2 T C 3: 129,218,469 Y130H probably damaging Het
Pmch G T 10: 88,091,386 probably null Het
Pofut2 T A 10: 77,268,586 I399N probably damaging Het
Prr36 C A 8: 4,214,177 probably benign Het
Ptprq C A 10: 107,517,887 C2256F probably damaging Het
Rassf5 G A 1: 131,244,979 A51V probably damaging Het
Retnla A G 16: 48,842,895 I54V probably benign Het
Rimbp2 A G 5: 128,803,897 L142P probably benign Het
Ripk1 A G 13: 34,032,501 T564A probably benign Het
Robo4 G A 9: 37,403,533 E228K probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Rusc1 A T 3: 89,089,012 L132Q probably damaging Het
Slc38a6 A T 12: 73,310,196 K122M probably damaging Het
Susd5 A T 9: 114,095,658 D203V probably damaging Het
Trip4 G A 9: 65,879,152 R110* probably null Het
Tuba4a T A 1: 75,216,874 I95F probably benign Het
Ube2q2 T A 9: 55,162,983 S70T probably benign Het
Umodl1 A G 17: 30,996,282 I1027V possibly damaging Het
Unc80 G A 1: 66,677,471 V2917I probably benign Het
Vmn1r70 T A 7: 10,633,671 C29S probably benign Het
Vmn2r94 A T 17: 18,257,734 D138E probably benign Het
Wee2 C T 6: 40,449,683 H129Y probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp872 A T 9: 22,197,131 D42V probably benign Het
Zic5 T G 14: 122,464,974 D115A unknown Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
R7988:Setd1a UTSW 7 127786194 missense probably benign 0.02
R8029:Setd1a UTSW 7 127786214 missense probably benign 0.08
R8079:Setd1a UTSW 7 127785053 missense unknown
R8171:Setd1a UTSW 7 127791227 missense unknown
R8175:Setd1a UTSW 7 127796243 missense unknown
R8286:Setd1a UTSW 7 127786184 missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127791497 missense unknown
R8460:Setd1a UTSW 7 127784120 missense unknown
R8547:Setd1a UTSW 7 127796504 unclassified probably benign
R8699:Setd1a UTSW 7 127786602 missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127786160 missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127786107 missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127786386 missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127786418 missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127786065 missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127786580 missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127785314 unclassified probably benign
RF008:Setd1a UTSW 7 127785314 unclassified probably benign
RF011:Setd1a UTSW 7 127785343 unclassified probably benign
RF014:Setd1a UTSW 7 127785346 unclassified probably benign
RF030:Setd1a UTSW 7 127785301 unclassified probably benign
RF030:Setd1a UTSW 7 127785311 unclassified probably benign
RF031:Setd1a UTSW 7 127785311 unclassified probably benign
RF036:Setd1a UTSW 7 127785300 unclassified probably benign
RF041:Setd1a UTSW 7 127785332 unclassified probably benign
RF052:Setd1a UTSW 7 127785357 unclassified probably benign
RF055:Setd1a UTSW 7 127785299 unclassified probably benign
RF056:Setd1a UTSW 7 127785303 unclassified probably benign
RF056:Setd1a UTSW 7 127785328 unclassified probably benign
RF058:Setd1a UTSW 7 127785318 unclassified probably benign
Z1176:Setd1a UTSW 7 127799094 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTAAGTCGTGGACTCCCATTC -3'
(R):5'- CTGAAAATTCACCAGCCTACTG -3'

Sequencing Primer
(F):5'- CCTCTTTTCCTGACAGTGTAAATGAG -3'
(R):5'- TGACTCTATAAAGCCCATGTAGAAGC -3'
Posted On 2018-02-27