Mutagenetix > Incidental Mutations

Incidental Mutation 'R6189:Itgam'

502387

Institutional Source

Beutler Lab

Gene Symbol

Itgam

Ensembl Gene

ENSMUSG00000030786

Gene Name

integrin alpha M

Synonyms

Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3

MMRRC Submission

044329-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R6189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128062640-128118491 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128112504 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 764 (M764V)

Ref Sequence

ENSEMBL: ENSMUSP00000113957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]

Predicted Effect

probably benign
Transcript: ENSMUST00000064821
AA Change: M764V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: M764V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
Pfam:Integrin_alpha	1130	1144	2.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098015
AA Change: M763V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: M763V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106240
AA Change: M646V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: M646V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	462	516	3.67e-3	SMART
low complexity region	732	738	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106242
AA Change: M763V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: M763V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
Pfam:Integrin_alpha	1131	1145	8.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120355
AA Change: M764V

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: M764V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
low complexity region	1141	1150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134694

SMART Domains

Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L29	39	82	1.1e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	G	17: 48,167,054		probably benign	Het
Abca8a	T	C	11: 110,030,884	D1448G	probably damaging	Het
Actn2	C	T	13: 12,276,440	D693N	probably damaging	Het
Adam3	A	C	8: 24,711,336	I267R	probably benign	Het
Akap2	A	G	4: 57,855,928	E419G	probably benign	Het
Aldh1l2	A	G	10: 83,508,013		probably null	Het
C4bp	T	C	1: 130,636,819	Y376C	probably damaging	Het
Cacna1h	A	G	17: 25,397,844	W101R	probably damaging	Het
Ccdc84	G	A	9: 44,410,321	R328C	probably benign	Het
Ccdc97	T	A	7: 25,716,098	T47S	probably benign	Het
Cnot6l	G	A	5: 96,098,277	T171I	probably benign	Het
Cntnap2	T	A	6: 47,271,298	S1213T	probably damaging	Het
Cxcl10	A	T	5: 92,348,113	L55Q	probably benign	Het
Cyp1a1	T	C	9: 57,700,683	V198A	probably damaging	Het
Dclre1b	A	G	3: 103,803,533	V354A	probably damaging	Het
Dmxl1	C	T	18: 49,893,335	H1837Y	probably benign	Het
Dnajc13	G	C	9: 104,213,886	D665E	probably benign	Het
Dnmbp	T	C	19: 43,890,309	T108A	probably benign	Het
Dnmbp	T	A	19: 43,901,511	T606S	probably benign	Het
Dok5	T	A	2: 170,800,851	I23N	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epha5	A	T	5: 84,237,540	F311I	probably damaging	Het
Erbb4	T	A	1: 68,043,916	M1059L	probably benign	Het
Fbxo40	A	G	16: 36,966,164	I681T	probably benign	Het
Flg2	T	A	3: 93,220,074	C2098S	unknown	Het
Gm10471	A	G	5: 26,085,693	I160T	probably benign	Het
Gm11397	A	T	13: 33,404,444	E337D	probably benign	Het
Gpr87	T	A	3: 59,179,229	D285V	probably damaging	Het
Hrh1	T	A	6: 114,479,998	V80D	probably damaging	Het
Hunk	G	A	16: 90,487,881	R351K	probably benign	Het
Ifna12	A	G	4: 88,603,011	W100R	probably damaging	Het
Ift57	G	A	16: 49,763,813	G310S	probably damaging	Het
Igf1r	T	A	7: 68,207,336	Y1015*	probably null	Het
Igkv14-130	T	C	6: 67,791,448	I96T	probably damaging	Het
Il34	C	T	8: 110,742,718	S155N	probably benign	Het
Itga7	T	C	10: 128,950,403	S938P	possibly damaging	Het
Lao1	T	A	4: 118,967,880	M299K	probably benign	Het
Lnpep	A	T	17: 17,566,739	S533T	possibly damaging	Het
Lrp4	T	C	2: 91,475,234	V283A	possibly damaging	Het
Magi3	G	T	3: 104,050,865	H635N	probably damaging	Het
Mecr	A	T	4: 131,865,254		probably null	Het
Mgrn1	T	C	16: 4,910,810		probably null	Het
Micalcl	A	C	7: 112,412,880	N646H	probably damaging	Het
Mymk	C	T	2: 27,067,365	V39I	possibly damaging	Het
Nav3	T	C	10: 109,720,019	S1684G	probably damaging	Het
Ntn5	A	T	7: 45,693,220	D330V	probably benign	Het
Nupl2	G	T	5: 24,175,454	G149V	probably damaging	Het
Nutm2	T	A	13: 50,469,738	V157D	possibly damaging	Het
Obscn	T	C	11: 59,069,934	I3460V	probably benign	Het
Olfr1037	A	T	2: 86,084,913	M288K	possibly damaging	Het
Pcdh15	C	T	10: 74,342,651	A580V	probably null	Het
Pcdhb10	T	A	18: 37,412,403	H177Q	probably damaging	Het
Pitx2	T	C	3: 129,218,469	Y130H	probably damaging	Het
Pmch	G	T	10: 88,091,386		probably null	Het
Pofut2	T	A	10: 77,268,586	I399N	probably damaging	Het
Prr36	C	A	8: 4,214,177		probably benign	Het
Ptprq	C	A	10: 107,517,887	C2256F	probably damaging	Het
Rassf5	G	A	1: 131,244,979	A51V	probably damaging	Het
Retnla	A	G	16: 48,842,895	I54V	probably benign	Het
Rimbp2	A	G	5: 128,803,897	L142P	probably benign	Het
Ripk1	A	G	13: 34,032,501	T564A	probably benign	Het
Robo4	G	A	9: 37,403,533	E228K	probably benign	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Homo
Rusc1	A	T	3: 89,089,012	L132Q	probably damaging	Het
Setd1a	T	C	7: 127,778,283		probably null	Het
Slc38a6	A	T	12: 73,310,196	K122M	probably damaging	Het
Susd5	A	T	9: 114,095,658	D203V	probably damaging	Het
Trip4	G	A	9: 65,879,152	R110*	probably null	Het
Tuba4a	T	A	1: 75,216,874	I95F	probably benign	Het
Ube2q2	T	A	9: 55,162,983	S70T	probably benign	Het
Umodl1	A	G	17: 30,996,282	I1027V	possibly damaging	Het
Unc80	G	A	1: 66,677,471	V2917I	probably benign	Het
Vmn1r70	T	A	7: 10,633,671	C29S	probably benign	Het
Vmn2r94	A	T	17: 18,257,734	D138E	probably benign	Het
Wee2	C	T	6: 40,449,683	H129Y	probably damaging	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp872	A	T	9: 22,197,131	D42V	probably benign	Het
Zic5	T	G	14: 122,464,974	D115A	unknown	Het

Other mutations in Itgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Itgam	APN	7	128085661	missense	probably damaging	1.00
IGL00983:Itgam	APN	7	128068667	missense	probably damaging	0.97
IGL01102:Itgam	APN	7	128080273	missense	possibly damaging	0.94
IGL01615:Itgam	APN	7	128116767	missense	possibly damaging	0.80
IGL01845:Itgam	APN	7	128112472	missense	probably damaging	1.00
IGL01860:Itgam	APN	7	128070943	missense	probably benign	0.03
IGL01874:Itgam	APN	7	128115166	missense	probably damaging	0.97
IGL01910:Itgam	APN	7	128083776	missense	probably damaging	1.00
IGL01994:Itgam	APN	7	128101727	missense	probably damaging	0.97
IGL02332:Itgam	APN	7	128085674	critical splice donor site	probably null
IGL02348:Itgam	APN	7	128116300	missense	possibly damaging	0.52
IGL02394:Itgam	APN	7	128084942	missense	probably benign	0.01
IGL02491:Itgam	APN	7	128116018	missense	possibly damaging	0.71
IGL02695:Itgam	APN	7	128085941	missense	possibly damaging	0.81
IGL02821:Itgam	APN	7	128076109	missense	probably damaging	0.99
IGL02970:Itgam	APN	7	128086043	missense	probably benign	0.00
IGL03145:Itgam	APN	7	128113019	missense	probably benign	0.12
adhesion	UTSW	7	128101537	missense	probably damaging	0.99
apparition	UTSW	7	128112286	splice site	probably null
attachment	UTSW	7	128113033	missense	probably damaging	1.00
Follower	UTSW	7	128080264	missense	probably damaging	1.00
invisible	UTSW	7	128070703	splice site	probably null
obscured	UTSW	7	128081634	missense	probably damaging	1.00
R0184:Itgam	UTSW	7	128086058	missense	probably damaging	0.96
R0389:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0443:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0454:Itgam	UTSW	7	128107980	missense	probably benign	0.01
R0674:Itgam	UTSW	7	128116218	missense	possibly damaging	0.67
R0828:Itgam	UTSW	7	128116505	critical splice donor site	probably null
R0925:Itgam	UTSW	7	128112238	missense	probably benign	0.00
R1086:Itgam	UTSW	7	128080264	missense	probably damaging	1.00
R1655:Itgam	UTSW	7	128115163	missense	probably benign	0.00
R1809:Itgam	UTSW	7	128070937	missense	possibly damaging	0.62
R1823:Itgam	UTSW	7	128064732	missense	probably benign	0.04
R2105:Itgam	UTSW	7	128081712	missense	probably damaging	1.00
R2154:Itgam	UTSW	7	128085577	missense	probably damaging	0.99
R2656:Itgam	UTSW	7	128116815	missense	probably null	1.00
R2913:Itgam	UTSW	7	128112406	missense	probably damaging	1.00
R3116:Itgam	UTSW	7	128116029	missense	probably damaging	1.00
R3404:Itgam	UTSW	7	128070703	splice site	probably null
R3821:Itgam	UTSW	7	128112286	splice site	probably null
R3822:Itgam	UTSW	7	128112286	splice site	probably null
R3960:Itgam	UTSW	7	128115175	missense	probably benign	0.02
R3968:Itgam	UTSW	7	128113033	missense	probably damaging	1.00
R4192:Itgam	UTSW	7	128064732	missense	probably benign	0.21
R4400:Itgam	UTSW	7	128081658	missense	probably damaging	1.00
R4708:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4709:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4742:Itgam	UTSW	7	128113073	missense	probably damaging	1.00
R4790:Itgam	UTSW	7	128116273	missense	probably benign	0.01
R4960:Itgam	UTSW	7	128115840	missense	possibly damaging	0.93
R5109:Itgam	UTSW	7	128113218	missense	probably benign	0.06
R5190:Itgam	UTSW	7	128116317	splice site	probably null
R5379:Itgam	UTSW	7	128112388	missense	probably damaging	1.00
R5386:Itgam	UTSW	7	128107980	missense	probably benign	0.00
R6104:Itgam	UTSW	7	128116302	missense	possibly damaging	0.85
R6122:Itgam	UTSW	7	128085652	missense	probably damaging	0.99
R6282:Itgam	UTSW	7	128084942	missense	probably benign	0.01
R6545:Itgam	UTSW	7	128107872	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCTCCTGACTGAGGGTG -3'
(R):5'- TCGTCTTGGCAGATGCTGTC -3'

Sequencing Primer
(F):5'- TGGGGAGGTCTTAGGAAACTG -3'
(R):5'- TGCCGCAATTTTTCTCAAAGGG -3'

Posted On

2018-02-27