Incidental Mutation 'R6189:Prr36'
ID502388
Institutional Source Beutler Lab
Gene Symbol Prr36
Ensembl Gene ENSMUSG00000064125
Gene Nameproline rich 36
SynonymsBC068157
MMRRC Submission 044329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6189 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4209543-4217459 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 4214177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000175906] [ENSMUST00000176227] [ENSMUST00000177491]
Predicted Effect unknown
Transcript: ENSMUST00000168386
AA Change: L496F
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125
AA Change: L496F

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175906
SMART Domains Protein: ENSMUSP00000135713
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.38e-8 PROSPERO
internal_repeat_1 87 106 5.38e-8 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176227
Predicted Effect probably benign
Transcript: ENSMUST00000176645
Predicted Effect probably benign
Transcript: ENSMUST00000177491
SMART Domains Protein: ENSMUSP00000135130
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 1.65e-6 PROSPERO
internal_repeat_1 87 106 1.65e-6 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein of unknown function that contains internal regions of low complexity sequence. Alternative splicing results in multiple transcript variants. The transcript structure of the protein-coding variant at this locus is conserved between human and mouse. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,167,054 probably benign Het
Abca8a T C 11: 110,030,884 D1448G probably damaging Het
Actn2 C T 13: 12,276,440 D693N probably damaging Het
Adam3 A C 8: 24,711,336 I267R probably benign Het
Akap2 A G 4: 57,855,928 E419G probably benign Het
Aldh1l2 A G 10: 83,508,013 probably null Het
C4bp T C 1: 130,636,819 Y376C probably damaging Het
Cacna1h A G 17: 25,397,844 W101R probably damaging Het
Ccdc84 G A 9: 44,410,321 R328C probably benign Het
Ccdc97 T A 7: 25,716,098 T47S probably benign Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cntnap2 T A 6: 47,271,298 S1213T probably damaging Het
Cxcl10 A T 5: 92,348,113 L55Q probably benign Het
Cyp1a1 T C 9: 57,700,683 V198A probably damaging Het
Dclre1b A G 3: 103,803,533 V354A probably damaging Het
Dmxl1 C T 18: 49,893,335 H1837Y probably benign Het
Dnajc13 G C 9: 104,213,886 D665E probably benign Het
Dnmbp T C 19: 43,890,309 T108A probably benign Het
Dnmbp T A 19: 43,901,511 T606S probably benign Het
Dok5 T A 2: 170,800,851 I23N probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha5 A T 5: 84,237,540 F311I probably damaging Het
Erbb4 T A 1: 68,043,916 M1059L probably benign Het
Fbxo40 A G 16: 36,966,164 I681T probably benign Het
Flg2 T A 3: 93,220,074 C2098S unknown Het
Gm10471 A G 5: 26,085,693 I160T probably benign Het
Gm11397 A T 13: 33,404,444 E337D probably benign Het
Gpr87 T A 3: 59,179,229 D285V probably damaging Het
Hrh1 T A 6: 114,479,998 V80D probably damaging Het
Hunk G A 16: 90,487,881 R351K probably benign Het
Ifna12 A G 4: 88,603,011 W100R probably damaging Het
Ift57 G A 16: 49,763,813 G310S probably damaging Het
Igf1r T A 7: 68,207,336 Y1015* probably null Het
Igkv14-130 T C 6: 67,791,448 I96T probably damaging Het
Il34 C T 8: 110,742,718 S155N probably benign Het
Itga7 T C 10: 128,950,403 S938P possibly damaging Het
Itgam A G 7: 128,112,504 M764V probably benign Het
Lao1 T A 4: 118,967,880 M299K probably benign Het
Lnpep A T 17: 17,566,739 S533T possibly damaging Het
Lrp4 T C 2: 91,475,234 V283A possibly damaging Het
Magi3 G T 3: 104,050,865 H635N probably damaging Het
Mecr A T 4: 131,865,254 probably null Het
Mgrn1 T C 16: 4,910,810 probably null Het
Micalcl A C 7: 112,412,880 N646H probably damaging Het
Mymk C T 2: 27,067,365 V39I possibly damaging Het
Nav3 T C 10: 109,720,019 S1684G probably damaging Het
Ntn5 A T 7: 45,693,220 D330V probably benign Het
Nupl2 G T 5: 24,175,454 G149V probably damaging Het
Nutm2 T A 13: 50,469,738 V157D possibly damaging Het
Obscn T C 11: 59,069,934 I3460V probably benign Het
Olfr1037 A T 2: 86,084,913 M288K possibly damaging Het
Pcdh15 C T 10: 74,342,651 A580V probably null Het
Pcdhb10 T A 18: 37,412,403 H177Q probably damaging Het
Pitx2 T C 3: 129,218,469 Y130H probably damaging Het
Pmch G T 10: 88,091,386 probably null Het
Pofut2 T A 10: 77,268,586 I399N probably damaging Het
Ptprq C A 10: 107,517,887 C2256F probably damaging Het
Rassf5 G A 1: 131,244,979 A51V probably damaging Het
Retnla A G 16: 48,842,895 I54V probably benign Het
Rimbp2 A G 5: 128,803,897 L142P probably benign Het
Ripk1 A G 13: 34,032,501 T564A probably benign Het
Robo4 G A 9: 37,403,533 E228K probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Rusc1 A T 3: 89,089,012 L132Q probably damaging Het
Setd1a T C 7: 127,778,283 probably null Het
Slc38a6 A T 12: 73,310,196 K122M probably damaging Het
Susd5 A T 9: 114,095,658 D203V probably damaging Het
Trip4 G A 9: 65,879,152 R110* probably null Het
Tuba4a T A 1: 75,216,874 I95F probably benign Het
Ube2q2 T A 9: 55,162,983 S70T probably benign Het
Umodl1 A G 17: 30,996,282 I1027V possibly damaging Het
Unc80 G A 1: 66,677,471 V2917I probably benign Het
Vmn1r70 T A 7: 10,633,671 C29S probably benign Het
Vmn2r94 A T 17: 18,257,734 D138E probably benign Het
Wee2 C T 6: 40,449,683 H129Y probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp872 A T 9: 22,197,131 D42V probably benign Het
Zic5 T G 14: 122,464,974 D115A unknown Het
Other mutations in Prr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Prr36 APN 8 4216230 missense probably benign 0.01
IGL01535:Prr36 APN 8 4214043 unclassified probably benign
IGL01658:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01710:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01712:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01713:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01892:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01893:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL02496:Prr36 APN 8 4216407 nonsense probably null
IGL02829:Prr36 APN 8 4215278 missense possibly damaging 0.55
R0479:Prr36 UTSW 8 4213930 nonsense probably null
R0667:Prr36 UTSW 8 4216311 unclassified probably benign
R0784:Prr36 UTSW 8 4213771 unclassified probably benign
R1737:Prr36 UTSW 8 4214370 unclassified probably benign
R2017:Prr36 UTSW 8 4215205 missense probably benign 0.02
R2032:Prr36 UTSW 8 4214304 unclassified probably benign
R2430:Prr36 UTSW 8 4213488 unclassified probably benign
R4160:Prr36 UTSW 8 4212910 missense probably benign 0.10
R4184:Prr36 UTSW 8 4213409 unclassified probably benign
R4393:Prr36 UTSW 8 4214901 unclassified probably benign
R4887:Prr36 UTSW 8 4210881 missense probably benign 0.01
R5508:Prr36 UTSW 8 4216488 missense probably damaging 0.99
R5628:Prr36 UTSW 8 4216273 small deletion probably benign
R6277:Prr36 UTSW 8 4214746 unclassified probably benign
R7185:Prr36 UTSW 8 4216458 missense probably damaging 1.00
R7286:Prr36 UTSW 8 4215163 critical splice donor site probably benign
R7338:Prr36 UTSW 8 4216212 missense probably damaging 1.00
R7604:Prr36 UTSW 8 4214836 missense unknown
R7621:Prr36 UTSW 8 4213150 missense unknown
R7703:Prr36 UTSW 8 4212982 missense probably benign 0.03
RF044:Prr36 UTSW 8 4216273 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGAAAGTGGGAGCCTC -3'
(R):5'- GAGCTGTAATCTCTTCATCGCC -3'

Sequencing Primer
(F):5'- TCAGAGGAGGCGTGACCAC -3'
(R):5'- GCCCCCTCCCCTTATACAGAATATG -3'
Posted On2018-02-27