Mutagenetix > Incidental Mutation

Incidental Mutation 'R6189:Aldh1l2'

502401

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

044329-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 83508013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably null
Transcript: ENSMUST00000020497

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

probably null
Transcript: ENSMUST00000146640

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Meta Mutation Damage Score

0.9581

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	G	17: 48,167,054		probably benign	Het
Abca8a	T	C	11: 110,030,884	D1448G	probably damaging	Het
Actn2	C	T	13: 12,276,440	D693N	probably damaging	Het
Adam3	A	C	8: 24,711,336	I267R	probably benign	Het
Akap2	A	G	4: 57,855,928	E419G	probably benign	Het
C4bp	T	C	1: 130,636,819	Y376C	probably damaging	Het
Cacna1h	A	G	17: 25,397,844	W101R	probably damaging	Het
Ccdc84	G	A	9: 44,410,321	R328C	probably benign	Het
Ccdc97	T	A	7: 25,716,098	T47S	probably benign	Het
Cnot6l	G	A	5: 96,098,277	T171I	probably benign	Het
Cntnap2	T	A	6: 47,271,298	S1213T	probably damaging	Het
Cxcl10	A	T	5: 92,348,113	L55Q	probably benign	Het
Cyp1a1	T	C	9: 57,700,683	V198A	probably damaging	Het
Dclre1b	A	G	3: 103,803,533	V354A	probably damaging	Het
Dmxl1	C	T	18: 49,893,335	H1837Y	probably benign	Het
Dnajc13	G	C	9: 104,213,886	D665E	probably benign	Het
Dnmbp	T	C	19: 43,890,309	T108A	probably benign	Het
Dnmbp	T	A	19: 43,901,511	T606S	probably benign	Het
Dok5	T	A	2: 170,800,851	I23N	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epha5	A	T	5: 84,237,540	F311I	probably damaging	Het
Erbb4	T	A	1: 68,043,916	M1059L	probably benign	Het
Fbxo40	A	G	16: 36,966,164	I681T	probably benign	Het
Flg2	T	A	3: 93,220,074	C2098S	unknown	Het
Gm10471	A	G	5: 26,085,693	I160T	probably benign	Het
Gm11397	A	T	13: 33,404,444	E337D	probably benign	Het
Gpr87	T	A	3: 59,179,229	D285V	probably damaging	Het
Hrh1	T	A	6: 114,479,998	V80D	probably damaging	Het
Hunk	G	A	16: 90,487,881	R351K	probably benign	Het
Ifna12	A	G	4: 88,603,011	W100R	probably damaging	Het
Ift57	G	A	16: 49,763,813	G310S	probably damaging	Het
Igf1r	T	A	7: 68,207,336	Y1015*	probably null	Het
Igkv14-130	T	C	6: 67,791,448	I96T	probably damaging	Het
Il34	C	T	8: 110,742,718	S155N	probably benign	Het
Itga7	T	C	10: 128,950,403	S938P	possibly damaging	Het
Itgam	A	G	7: 128,112,504	M764V	probably benign	Het
Lao1	T	A	4: 118,967,880	M299K	probably benign	Het
Lnpep	A	T	17: 17,566,739	S533T	possibly damaging	Het
Lrp4	T	C	2: 91,475,234	V283A	possibly damaging	Het
Magi3	G	T	3: 104,050,865	H635N	probably damaging	Het
Mecr	A	T	4: 131,865,254		probably null	Het
Mgrn1	T	C	16: 4,910,810		probably null	Het
Micalcl	A	C	7: 112,412,880	N646H	probably damaging	Het
Mymk	C	T	2: 27,067,365	V39I	possibly damaging	Het
Nav3	T	C	10: 109,720,019	S1684G	probably damaging	Het
Ntn5	A	T	7: 45,693,220	D330V	probably benign	Het
Nupl2	G	T	5: 24,175,454	G149V	probably damaging	Het
Nutm2	T	A	13: 50,469,738	V157D	possibly damaging	Het
Obscn	T	C	11: 59,069,934	I3460V	probably benign	Het
Olfr1037	A	T	2: 86,084,913	M288K	possibly damaging	Het
Pcdh15	C	T	10: 74,342,651	A580V	probably null	Het
Pcdhb10	T	A	18: 37,412,403	H177Q	probably damaging	Het
Pitx2	T	C	3: 129,218,469	Y130H	probably damaging	Het
Pmch	G	T	10: 88,091,386		probably null	Het
Pofut2	T	A	10: 77,268,586	I399N	probably damaging	Het
Prr36	C	A	8: 4,214,177		probably benign	Het
Ptprq	C	A	10: 107,517,887	C2256F	probably damaging	Het
Rassf5	G	A	1: 131,244,979	A51V	probably damaging	Het
Retnla	A	G	16: 48,842,895	I54V	probably benign	Het
Rimbp2	A	G	5: 128,803,897	L142P	probably benign	Het
Ripk1	A	G	13: 34,032,501	T564A	probably benign	Het
Robo4	G	A	9: 37,403,533	E228K	probably benign	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Homo
Rusc1	A	T	3: 89,089,012	L132Q	probably damaging	Het
Setd1a	T	C	7: 127,778,283		probably null	Het
Slc38a6	A	T	12: 73,310,196	K122M	probably damaging	Het
Susd5	A	T	9: 114,095,658	D203V	probably damaging	Het
Trip4	G	A	9: 65,879,152	R110*	probably null	Het
Tuba4a	T	A	1: 75,216,874	I95F	probably benign	Het
Ube2q2	T	A	9: 55,162,983	S70T	probably benign	Het
Umodl1	A	G	17: 30,996,282	I1027V	possibly damaging	Het
Unc80	G	A	1: 66,677,471	V2917I	probably benign	Het
Vmn1r70	T	A	7: 10,633,671	C29S	probably benign	Het
Vmn2r94	A	T	17: 18,257,734	D138E	probably benign	Het
Wee2	C	T	6: 40,449,683	H129Y	probably damaging	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp872	A	T	9: 22,197,131	D42V	probably benign	Het
Zic5	T	G	14: 122,464,974	D115A	unknown	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCACCTGGTGACTGACACTTG -3'
(R):5'- GCATCAATAGATCCCTCAGTGAC -3'

Sequencing Primer
(F):5'- GACATGGTCAATGGGTTAAATCCCC -3'
(R):5'- AATAGATCCCTCAGTGACCTATTTC -3'

Posted On

2018-02-27