Incidental Mutation 'R6189:Nav3'
ID502404
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 044329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6189 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109720019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1684 (S1684G)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: S1684G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: S1684G

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,167,054 probably benign Het
Abca8a T C 11: 110,030,884 D1448G probably damaging Het
Actn2 C T 13: 12,276,440 D693N probably damaging Het
Adam3 A C 8: 24,711,336 I267R probably benign Het
Akap2 A G 4: 57,855,928 E419G probably benign Het
Aldh1l2 A G 10: 83,508,013 probably null Het
C4bp T C 1: 130,636,819 Y376C probably damaging Het
Cacna1h A G 17: 25,397,844 W101R probably damaging Het
Ccdc84 G A 9: 44,410,321 R328C probably benign Het
Ccdc97 T A 7: 25,716,098 T47S probably benign Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cntnap2 T A 6: 47,271,298 S1213T probably damaging Het
Cxcl10 A T 5: 92,348,113 L55Q probably benign Het
Cyp1a1 T C 9: 57,700,683 V198A probably damaging Het
Dclre1b A G 3: 103,803,533 V354A probably damaging Het
Dmxl1 C T 18: 49,893,335 H1837Y probably benign Het
Dnajc13 G C 9: 104,213,886 D665E probably benign Het
Dnmbp T C 19: 43,890,309 T108A probably benign Het
Dnmbp T A 19: 43,901,511 T606S probably benign Het
Dok5 T A 2: 170,800,851 I23N probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha5 A T 5: 84,237,540 F311I probably damaging Het
Erbb4 T A 1: 68,043,916 M1059L probably benign Het
Fbxo40 A G 16: 36,966,164 I681T probably benign Het
Flg2 T A 3: 93,220,074 C2098S unknown Het
Gm10471 A G 5: 26,085,693 I160T probably benign Het
Gm11397 A T 13: 33,404,444 E337D probably benign Het
Gpr87 T A 3: 59,179,229 D285V probably damaging Het
Hrh1 T A 6: 114,479,998 V80D probably damaging Het
Hunk G A 16: 90,487,881 R351K probably benign Het
Ifna12 A G 4: 88,603,011 W100R probably damaging Het
Ift57 G A 16: 49,763,813 G310S probably damaging Het
Igf1r T A 7: 68,207,336 Y1015* probably null Het
Igkv14-130 T C 6: 67,791,448 I96T probably damaging Het
Il34 C T 8: 110,742,718 S155N probably benign Het
Itga7 T C 10: 128,950,403 S938P possibly damaging Het
Itgam A G 7: 128,112,504 M764V probably benign Het
Lao1 T A 4: 118,967,880 M299K probably benign Het
Lnpep A T 17: 17,566,739 S533T possibly damaging Het
Lrp4 T C 2: 91,475,234 V283A possibly damaging Het
Magi3 G T 3: 104,050,865 H635N probably damaging Het
Mecr A T 4: 131,865,254 probably null Het
Mgrn1 T C 16: 4,910,810 probably null Het
Micalcl A C 7: 112,412,880 N646H probably damaging Het
Mymk C T 2: 27,067,365 V39I possibly damaging Het
Ntn5 A T 7: 45,693,220 D330V probably benign Het
Nupl2 G T 5: 24,175,454 G149V probably damaging Het
Nutm2 T A 13: 50,469,738 V157D possibly damaging Het
Obscn T C 11: 59,069,934 I3460V probably benign Het
Olfr1037 A T 2: 86,084,913 M288K possibly damaging Het
Pcdh15 C T 10: 74,342,651 A580V probably null Het
Pcdhb10 T A 18: 37,412,403 H177Q probably damaging Het
Pitx2 T C 3: 129,218,469 Y130H probably damaging Het
Pmch G T 10: 88,091,386 probably null Het
Pofut2 T A 10: 77,268,586 I399N probably damaging Het
Prr36 C A 8: 4,214,177 probably benign Het
Ptprq C A 10: 107,517,887 C2256F probably damaging Het
Rassf5 G A 1: 131,244,979 A51V probably damaging Het
Retnla A G 16: 48,842,895 I54V probably benign Het
Rimbp2 A G 5: 128,803,897 L142P probably benign Het
Ripk1 A G 13: 34,032,501 T564A probably benign Het
Robo4 G A 9: 37,403,533 E228K probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Rusc1 A T 3: 89,089,012 L132Q probably damaging Het
Setd1a T C 7: 127,778,283 probably null Het
Slc38a6 A T 12: 73,310,196 K122M probably damaging Het
Susd5 A T 9: 114,095,658 D203V probably damaging Het
Trip4 G A 9: 65,879,152 R110* probably null Het
Tuba4a T A 1: 75,216,874 I95F probably benign Het
Ube2q2 T A 9: 55,162,983 S70T probably benign Het
Umodl1 A G 17: 30,996,282 I1027V possibly damaging Het
Unc80 G A 1: 66,677,471 V2917I probably benign Het
Vmn1r70 T A 7: 10,633,671 C29S probably benign Het
Vmn2r94 A T 17: 18,257,734 D138E probably benign Het
Wee2 C T 6: 40,449,683 H129Y probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp872 A T 9: 22,197,131 D42V probably benign Het
Zic5 T G 14: 122,464,974 D115A unknown Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATACGAGGTCTTCACCAC -3'
(R):5'- AACTACAGTGGAGTGATAGCTG -3'

Sequencing Primer
(F):5'- AGATGCTGGTCCCTGAAGG -3'
(R):5'- TGATAGCTGTAGAAAGCCTTGC -3'
Posted On2018-02-27