Incidental Mutation 'R6190:Lrrc37a'
ID502496
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission 044330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6190 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103501216 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1128 (Q1128K)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000153273
AA Change: Q1128K

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: Q1128K

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,605,608 L224Q probably damaging Het
Abcc5 A G 16: 20,392,779 M478T probably benign Het
Acot10 T C 15: 20,665,785 D290G possibly damaging Het
Actr3b A G 5: 25,831,690 Q167R probably benign Het
Actr8 C T 14: 29,991,717 R565* probably null Het
Adcy7 C T 8: 88,325,730 probably null Het
Adgrb3 C T 1: 25,420,647 V576I probably benign Het
Adgrv1 T A 13: 81,459,763 probably null Het
Adgrv1 A T 13: 81,524,779 probably null Het
Ak2 A G 4: 128,999,183 D45G probably damaging Het
Ak9 C G 10: 41,422,407 Q1489E unknown Het
Ak9 A T 10: 41,422,408 Q1489L unknown Het
Akap12 C A 10: 4,356,268 S1026Y possibly damaging Het
Ankhd1 T G 18: 36,611,809 S601A possibly damaging Het
Apba2 A T 7: 64,739,880 E508V probably damaging Het
Arhgap18 A G 10: 26,846,035 M1V probably null Het
Arhgef10l G A 4: 140,542,762 T865M possibly damaging Het
Bdh1 T A 16: 31,449,897 V150D probably damaging Het
Becn1 A G 11: 101,295,374 C135R probably damaging Het
C2cd4d A G 3: 94,363,919 D164G probably benign Het
C87414 A T 5: 93,638,078 N114K probably benign Het
Cacna1e C A 1: 154,486,570 V424F possibly damaging Het
Capn7 C A 14: 31,363,603 T511K probably benign Het
Cdc5l G A 17: 45,408,017 P558S probably benign Het
Cep170 T A 1: 176,782,409 H112L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Clca3a1 A G 3: 144,758,060 V152A probably benign Het
Cnot10 G T 9: 114,632,723 T24K probably damaging Het
Cntnap5b T A 1: 100,379,075 I839N possibly damaging Het
Cyp4f13 A T 17: 32,929,873 D299E probably damaging Het
Dclk1 A G 3: 55,487,811 E128G probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dgcr8 T C 16: 18,284,410 T3A probably damaging Het
Dld A C 12: 31,344,848 I58S probably damaging Het
Dlg5 T A 14: 24,190,438 R248S probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Faf1 C T 4: 109,861,815 L373F probably damaging Het
Fam159a A T 4: 108,367,855 I170N probably damaging Het
Fam171b C T 2: 83,876,698 T304I probably benign Het
Fcgrt A T 7: 45,102,198 probably null Het
Gimap9 T C 6: 48,678,351 W291R probably damaging Het
Gm4847 G A 1: 166,630,323 A487V probably damaging Het
Gria4 T A 9: 4,420,199 I888F probably benign Het
Hapln2 T A 3: 88,023,293 I224F probably damaging Het
Herc1 T G 9: 66,376,381 L332R possibly damaging Het
Hmgxb4 T C 8: 75,023,299 V481A probably benign Het
Htr1d T C 4: 136,442,798 S113P probably damaging Het
Ift81 T C 5: 122,551,100 Q651R probably benign Het
Il17ra T C 6: 120,475,273 S199P probably damaging Het
Itih2 T C 2: 10,098,507 N723S probably benign Het
Jak1 A T 4: 101,175,128 V427E probably damaging Het
Krt23 C T 11: 99,485,758 D191N probably damaging Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Llgl2 G A 11: 115,846,986 R199Q probably benign Het
Lrrc74a T C 12: 86,736,489 V36A probably benign Het
M1ap T A 6: 83,003,896 D254E possibly damaging Het
Mal2 C T 15: 54,571,398 probably benign Het
Mbnl2 A G 14: 120,385,421 T124A probably benign Het
Nfatc1 A G 18: 80,712,670 S33P probably benign Het
Nfkbid A G 7: 30,425,737 N253S probably damaging Het
Ngfr T A 11: 95,574,441 I194F probably benign Het
Nhsl1 A G 10: 18,470,041 probably benign Het
Nol9 T A 4: 152,041,234 I214N possibly damaging Het
Olfr1047 T A 2: 86,228,234 T246S possibly damaging Het
Olfr477 T C 7: 107,991,100 L245P probably damaging Het
Olfr98 A G 17: 37,262,744 S307P probably benign Het
Pax3 C T 1: 78,192,549 S160N possibly damaging Het
Pde3b A G 7: 114,523,032 probably null Het
Pde5a A C 3: 122,729,307 E21A probably benign Het
Plcxd1 A G 5: 110,102,603 E270G probably damaging Het
Plxna1 T A 6: 89,356,604 K348* probably null Het
Prpmp5 T A 6: 132,312,729 H44L unknown Het
Psg21 G T 7: 18,655,001 D55E possibly damaging Het
Rasa1 C A 13: 85,233,695 A493S probably benign Het
Raver2 A G 4: 101,133,617 I396V probably benign Het
Rpa2 A G 4: 132,775,020 K138E probably benign Het
Rsad1 T C 11: 94,548,236 N133D probably damaging Het
Rusc1 T C 3: 89,091,881 D198G probably benign Het
Samsn1 A T 16: 75,870,915 Y258N probably damaging Het
Scap A G 9: 110,374,067 N270D probably benign Het
Smpd4 T C 16: 17,632,013 Y200H probably damaging Het
Steap2 A G 5: 5,675,881 V381A probably damaging Het
Syk C T 13: 52,611,053 T72I probably damaging Het
Tbc1d14 T C 5: 36,571,884 D66G possibly damaging Het
Tcp11 A G 17: 28,071,717 Y223H probably benign Het
Timm9 A G 12: 71,126,350 S8P probably benign Het
Tmpo T C 10: 91,164,207 probably null Het
Vezf1 T C 11: 88,076,186 M81T probably benign Het
Vipr1 T A 9: 121,664,653 W257R probably damaging Het
Vmn1r237 G A 17: 21,314,294 G93D probably damaging Het
Vmn2r6 A G 3: 64,538,003 V678A probably benign Het
Vmn2r85 T C 10: 130,425,461 T336A possibly damaging Het
Xpnpep3 C A 15: 81,438,099 D296E probably benign Het
Zfp35 C A 18: 24,004,061 H487Q probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Zfp677 A G 17: 21,397,268 T196A possibly damaging Het
Zmym1 T C 4: 127,047,884 I904V probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103498236 missense unknown
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103497459 missense unknown
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GAAGTTCCTCAGGAGTTGGC -3'
(R):5'- AATGTAGGACCATCTCTAGTGC -3'

Sequencing Primer
(F):5'- CCTCAGGAGTTGGCTGTGGAC -3'
(R):5'- TAGGACCATCTCTAGTGCTACAG -3'
Posted On2018-02-27