Mutagenetix > Incidental Mutations

Incidental Mutation 'R6190:Rasa1'

502504

Institutional Source

Beutler Lab

Gene Symbol

Rasa1

Ensembl Gene

ENSMUSG00000021549

Gene Name

RAS p21 protein activator 1

Synonyms

p120-rasGAP, Gap

MMRRC Submission

044330-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6190 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85214780-85289130 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85233695 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 493 (A493S)

Ref Sequence

ENSEMBL: ENSMUSP00000105179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109552]

Predicted Effect

probably benign
Transcript: ENSMUST00000109552
AA Change: A493S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: A493S

Domain	Start	End	E-Value	Type
low complexity region	3	32	N/A	INTRINSIC
low complexity region	37	106	N/A	INTRINSIC
low complexity region	119	142	N/A	INTRINSIC
SH2	170	253	9.44e-29	SMART
SH3	273	331	1.7e-10	SMART
SH2	340	423	7.44e-27	SMART
PH	466	570	5.11e-20	SMART
C2	586	680	6.9e-10	SMART
RasGAP	689	1035	2.77e-156	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153231

Predicted Effect

probably benign
Transcript: ENSMUST00000223598

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	T	A	16: 8,605,608	L224Q	probably damaging	Het
Abcc5	A	G	16: 20,392,779	M478T	probably benign	Het
Acot10	T	C	15: 20,665,785	D290G	possibly damaging	Het
Actr3b	A	G	5: 25,831,690	Q167R	probably benign	Het
Actr8	C	T	14: 29,991,717	R565*	probably null	Het
Adcy7	C	T	8: 88,325,730		probably null	Het
Adgrb3	C	T	1: 25,420,647	V576I	probably benign	Het
Adgrv1	T	A	13: 81,459,763		probably null	Het
Adgrv1	A	T	13: 81,524,779		probably null	Het
Ak2	A	G	4: 128,999,183	D45G	probably damaging	Het
Ak9	C	G	10: 41,422,407	Q1489E	unknown	Het
Ak9	A	T	10: 41,422,408	Q1489L	unknown	Het
Akap12	C	A	10: 4,356,268	S1026Y	possibly damaging	Het
Ankhd1	T	G	18: 36,611,809	S601A	possibly damaging	Het
Apba2	A	T	7: 64,739,880	E508V	probably damaging	Het
Arhgap18	A	G	10: 26,846,035	M1V	probably null	Het
Arhgef10l	G	A	4: 140,542,762	T865M	possibly damaging	Het
Bdh1	T	A	16: 31,449,897	V150D	probably damaging	Het
Becn1	A	G	11: 101,295,374	C135R	probably damaging	Het
C2cd4d	A	G	3: 94,363,919	D164G	probably benign	Het
C87414	A	T	5: 93,638,078	N114K	probably benign	Het
Cacna1e	C	A	1: 154,486,570	V424F	possibly damaging	Het
Capn7	C	A	14: 31,363,603	T511K	probably benign	Het
Cdc5l	G	A	17: 45,408,017	P558S	probably benign	Het
Cep170	T	A	1: 176,782,409	H112L	probably damaging	Het
Cfap61	C	T	2: 145,947,133	T19M	probably benign	Het
Clca3a1	A	G	3: 144,758,060	V152A	probably benign	Het
Cnot10	G	T	9: 114,632,723	T24K	probably damaging	Het
Cntnap5b	T	A	1: 100,379,075	I839N	possibly damaging	Het
Cyp4f13	A	T	17: 32,929,873	D299E	probably damaging	Het
Dclk1	A	G	3: 55,487,811	E128G	probably damaging	Het
Dennd1b	T	C	1: 139,133,675	I365T	probably damaging	Het
Dgcr8	T	C	16: 18,284,410	T3A	probably damaging	Het
Dld	A	C	12: 31,344,848	I58S	probably damaging	Het
Dlg5	T	A	14: 24,190,438	R248S	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Faf1	C	T	4: 109,861,815	L373F	probably damaging	Het
Fam159a	A	T	4: 108,367,855	I170N	probably damaging	Het
Fam171b	C	T	2: 83,876,698	T304I	probably benign	Het
Fcgrt	A	T	7: 45,102,198		probably null	Het
Gimap9	T	C	6: 48,678,351	W291R	probably damaging	Het
Gm4847	G	A	1: 166,630,323	A487V	probably damaging	Het
Gria4	T	A	9: 4,420,199	I888F	probably benign	Het
Hapln2	T	A	3: 88,023,293	I224F	probably damaging	Het
Herc1	T	G	9: 66,376,381	L332R	possibly damaging	Het
Hmgxb4	T	C	8: 75,023,299	V481A	probably benign	Het
Htr1d	T	C	4: 136,442,798	S113P	probably damaging	Het
Ift81	T	C	5: 122,551,100	Q651R	probably benign	Het
Il17ra	T	C	6: 120,475,273	S199P	probably damaging	Het
Itih2	T	C	2: 10,098,507	N723S	probably benign	Het
Jak1	A	T	4: 101,175,128	V427E	probably damaging	Het
Krt23	C	T	11: 99,485,758	D191N	probably damaging	Het
Lingo1	T	A	9: 56,619,650	I552F	possibly damaging	Het
Llgl2	G	A	11: 115,846,986	R199Q	probably benign	Het
Lrrc37a	G	T	11: 103,501,216	Q1128K	possibly damaging	Het
Lrrc74a	T	C	12: 86,736,489	V36A	probably benign	Het
M1ap	T	A	6: 83,003,896	D254E	possibly damaging	Het
Mal2	C	T	15: 54,571,398		probably benign	Het
Mbnl2	A	G	14: 120,385,421	T124A	probably benign	Het
Nfatc1	A	G	18: 80,712,670	S33P	probably benign	Het
Nfkbid	A	G	7: 30,425,737	N253S	probably damaging	Het
Ngfr	T	A	11: 95,574,441	I194F	probably benign	Het
Nhsl1	A	G	10: 18,470,041		probably benign	Het
Nol9	T	A	4: 152,041,234	I214N	possibly damaging	Het
Olfr1047	T	A	2: 86,228,234	T246S	possibly damaging	Het
Olfr477	T	C	7: 107,991,100	L245P	probably damaging	Het
Olfr98	A	G	17: 37,262,744	S307P	probably benign	Het
Pax3	C	T	1: 78,192,549	S160N	possibly damaging	Het
Pde3b	A	G	7: 114,523,032		probably null	Het
Pde5a	A	C	3: 122,729,307	E21A	probably benign	Het
Plcxd1	A	G	5: 110,102,603	E270G	probably damaging	Het
Plxna1	T	A	6: 89,356,604	K348*	probably null	Het
Prpmp5	T	A	6: 132,312,729	H44L	unknown	Het
Psg21	G	T	7: 18,655,001	D55E	possibly damaging	Het
Raver2	A	G	4: 101,133,617	I396V	probably benign	Het
Rpa2	A	G	4: 132,775,020	K138E	probably benign	Het
Rsad1	T	C	11: 94,548,236	N133D	probably damaging	Het
Rusc1	T	C	3: 89,091,881	D198G	probably benign	Het
Samsn1	A	T	16: 75,870,915	Y258N	probably damaging	Het
Scap	A	G	9: 110,374,067	N270D	probably benign	Het
Smpd4	T	C	16: 17,632,013	Y200H	probably damaging	Het
Steap2	A	G	5: 5,675,881	V381A	probably damaging	Het
Syk	C	T	13: 52,611,053	T72I	probably damaging	Het
Tbc1d14	T	C	5: 36,571,884	D66G	possibly damaging	Het
Tcp11	A	G	17: 28,071,717	Y223H	probably benign	Het
Timm9	A	G	12: 71,126,350	S8P	probably benign	Het
Tmpo	T	C	10: 91,164,207		probably null	Het
Vezf1	T	C	11: 88,076,186	M81T	probably benign	Het
Vipr1	T	A	9: 121,664,653	W257R	probably damaging	Het
Vmn1r237	G	A	17: 21,314,294	G93D	probably damaging	Het
Vmn2r6	A	G	3: 64,538,003	V678A	probably benign	Het
Vmn2r85	T	C	10: 130,425,461	T336A	possibly damaging	Het
Xpnpep3	C	A	15: 81,438,099	D296E	probably benign	Het
Zfp35	C	A	18: 24,004,061	H487Q	probably benign	Het
Zfp606	A	T	7: 12,494,001	Y625F	probably damaging	Het
Zfp677	A	G	17: 21,397,268	T196A	possibly damaging	Het
Zmym1	T	C	4: 127,047,884	I904V	probably damaging	Het

Other mutations in Rasa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Rasa1	APN	13	85288429	missense	probably benign	0.02
IGL01396:Rasa1	APN	13	85258442	missense	probably benign	0.10
IGL01670:Rasa1	APN	13	85225490	missense	probably damaging	0.97
IGL02095:Rasa1	APN	13	85216155	missense	probably benign	0.10
IGL02822:Rasa1	APN	13	85252514	missense	probably damaging	0.97
IGL03126:Rasa1	APN	13	85256396	missense	possibly damaging	0.94
F5770:Rasa1	UTSW	13	85226945	unclassified	probably null
PIT4458001:Rasa1	UTSW	13	85227118	missense	possibly damaging	0.91
R1393:Rasa1	UTSW	13	85223522	missense	probably damaging	1.00
R1441:Rasa1	UTSW	13	85252421	splice site	probably null
R1907:Rasa1	UTSW	13	85226572	nonsense	probably null
R4243:Rasa1	UTSW	13	85244195	missense	probably damaging	1.00
R4593:Rasa1	UTSW	13	85238221	splice site	probably null
R4687:Rasa1	UTSW	13	85226635	missense	possibly damaging	0.89
R4689:Rasa1	UTSW	13	85238163	nonsense	probably null
R4753:Rasa1	UTSW	13	85288390	splice site	probably null
R4758:Rasa1	UTSW	13	85234448	missense	probably benign
R4774:Rasa1	UTSW	13	85250502	intron	probably benign
R5363:Rasa1	UTSW	13	85288555	missense	possibly damaging	0.86
R5375:Rasa1	UTSW	13	85288903	intron	probably benign
R6134:Rasa1	UTSW	13	85226626	missense	probably benign	0.01
R6755:Rasa1	UTSW	13	85226598	missense	possibly damaging	0.49
R7564:Rasa1	UTSW	13	85228708	missense	probably benign	0.09
X0023:Rasa1	UTSW	13	85233734	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGAAGCCATTCCATCCATATC -3'
(R):5'- AGAGGCATTTTGTAATTACACAGGG -3'

Sequencing Primer
(F):5'- TTGCACATACAGCTTAGACAAAAG -3'
(R):5'- CACAGGGATTGATCTATTCTT -3'

Posted On

2018-02-27