Incidental Mutation 'R6190:Rasa1'
ID502504
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene NameRAS p21 protein activator 1
Synonymsp120-rasGAP, Gap
MMRRC Submission 044330-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6190 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location85214780-85289130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85233695 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 493 (A493S)
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
Predicted Effect probably benign
Transcript: ENSMUST00000109552
AA Change: A493S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: A493S

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153231
Predicted Effect probably benign
Transcript: ENSMUST00000223598
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,605,608 L224Q probably damaging Het
Abcc5 A G 16: 20,392,779 M478T probably benign Het
Acot10 T C 15: 20,665,785 D290G possibly damaging Het
Actr3b A G 5: 25,831,690 Q167R probably benign Het
Actr8 C T 14: 29,991,717 R565* probably null Het
Adcy7 C T 8: 88,325,730 probably null Het
Adgrb3 C T 1: 25,420,647 V576I probably benign Het
Adgrv1 T A 13: 81,459,763 probably null Het
Adgrv1 A T 13: 81,524,779 probably null Het
Ak2 A G 4: 128,999,183 D45G probably damaging Het
Ak9 C G 10: 41,422,407 Q1489E unknown Het
Ak9 A T 10: 41,422,408 Q1489L unknown Het
Akap12 C A 10: 4,356,268 S1026Y possibly damaging Het
Ankhd1 T G 18: 36,611,809 S601A possibly damaging Het
Apba2 A T 7: 64,739,880 E508V probably damaging Het
Arhgap18 A G 10: 26,846,035 M1V probably null Het
Arhgef10l G A 4: 140,542,762 T865M possibly damaging Het
Bdh1 T A 16: 31,449,897 V150D probably damaging Het
Becn1 A G 11: 101,295,374 C135R probably damaging Het
C2cd4d A G 3: 94,363,919 D164G probably benign Het
C87414 A T 5: 93,638,078 N114K probably benign Het
Cacna1e C A 1: 154,486,570 V424F possibly damaging Het
Capn7 C A 14: 31,363,603 T511K probably benign Het
Cdc5l G A 17: 45,408,017 P558S probably benign Het
Cep170 T A 1: 176,782,409 H112L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Clca3a1 A G 3: 144,758,060 V152A probably benign Het
Cnot10 G T 9: 114,632,723 T24K probably damaging Het
Cntnap5b T A 1: 100,379,075 I839N possibly damaging Het
Cyp4f13 A T 17: 32,929,873 D299E probably damaging Het
Dclk1 A G 3: 55,487,811 E128G probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dgcr8 T C 16: 18,284,410 T3A probably damaging Het
Dld A C 12: 31,344,848 I58S probably damaging Het
Dlg5 T A 14: 24,190,438 R248S probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Faf1 C T 4: 109,861,815 L373F probably damaging Het
Fam159a A T 4: 108,367,855 I170N probably damaging Het
Fam171b C T 2: 83,876,698 T304I probably benign Het
Fcgrt A T 7: 45,102,198 probably null Het
Gimap9 T C 6: 48,678,351 W291R probably damaging Het
Gm4847 G A 1: 166,630,323 A487V probably damaging Het
Gria4 T A 9: 4,420,199 I888F probably benign Het
Hapln2 T A 3: 88,023,293 I224F probably damaging Het
Herc1 T G 9: 66,376,381 L332R possibly damaging Het
Hmgxb4 T C 8: 75,023,299 V481A probably benign Het
Htr1d T C 4: 136,442,798 S113P probably damaging Het
Ift81 T C 5: 122,551,100 Q651R probably benign Het
Il17ra T C 6: 120,475,273 S199P probably damaging Het
Itih2 T C 2: 10,098,507 N723S probably benign Het
Jak1 A T 4: 101,175,128 V427E probably damaging Het
Krt23 C T 11: 99,485,758 D191N probably damaging Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Llgl2 G A 11: 115,846,986 R199Q probably benign Het
Lrrc37a G T 11: 103,501,216 Q1128K possibly damaging Het
Lrrc74a T C 12: 86,736,489 V36A probably benign Het
M1ap T A 6: 83,003,896 D254E possibly damaging Het
Mal2 C T 15: 54,571,398 probably benign Het
Mbnl2 A G 14: 120,385,421 T124A probably benign Het
Nfatc1 A G 18: 80,712,670 S33P probably benign Het
Nfkbid A G 7: 30,425,737 N253S probably damaging Het
Ngfr T A 11: 95,574,441 I194F probably benign Het
Nhsl1 A G 10: 18,470,041 probably benign Het
Nol9 T A 4: 152,041,234 I214N possibly damaging Het
Olfr1047 T A 2: 86,228,234 T246S possibly damaging Het
Olfr477 T C 7: 107,991,100 L245P probably damaging Het
Olfr98 A G 17: 37,262,744 S307P probably benign Het
Pax3 C T 1: 78,192,549 S160N possibly damaging Het
Pde3b A G 7: 114,523,032 probably null Het
Pde5a A C 3: 122,729,307 E21A probably benign Het
Plcxd1 A G 5: 110,102,603 E270G probably damaging Het
Plxna1 T A 6: 89,356,604 K348* probably null Het
Prpmp5 T A 6: 132,312,729 H44L unknown Het
Psg21 G T 7: 18,655,001 D55E possibly damaging Het
Raver2 A G 4: 101,133,617 I396V probably benign Het
Rpa2 A G 4: 132,775,020 K138E probably benign Het
Rsad1 T C 11: 94,548,236 N133D probably damaging Het
Rusc1 T C 3: 89,091,881 D198G probably benign Het
Samsn1 A T 16: 75,870,915 Y258N probably damaging Het
Scap A G 9: 110,374,067 N270D probably benign Het
Smpd4 T C 16: 17,632,013 Y200H probably damaging Het
Steap2 A G 5: 5,675,881 V381A probably damaging Het
Syk C T 13: 52,611,053 T72I probably damaging Het
Tbc1d14 T C 5: 36,571,884 D66G possibly damaging Het
Tcp11 A G 17: 28,071,717 Y223H probably benign Het
Timm9 A G 12: 71,126,350 S8P probably benign Het
Tmpo T C 10: 91,164,207 probably null Het
Vezf1 T C 11: 88,076,186 M81T probably benign Het
Vipr1 T A 9: 121,664,653 W257R probably damaging Het
Vmn1r237 G A 17: 21,314,294 G93D probably damaging Het
Vmn2r6 A G 3: 64,538,003 V678A probably benign Het
Vmn2r85 T C 10: 130,425,461 T336A possibly damaging Het
Xpnpep3 C A 15: 81,438,099 D296E probably benign Het
Zfp35 C A 18: 24,004,061 H487Q probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Zfp677 A G 17: 21,397,268 T196A possibly damaging Het
Zmym1 T C 4: 127,047,884 I904V probably damaging Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 unclassified probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4753:Rasa1 UTSW 13 85288390 splice site probably null
R4758:Rasa1 UTSW 13 85234448 missense probably benign
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5363:Rasa1 UTSW 13 85288555 missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6134:Rasa1 UTSW 13 85226626 missense probably benign 0.01
R6755:Rasa1 UTSW 13 85226598 missense possibly damaging 0.49
R7564:Rasa1 UTSW 13 85228708 missense probably benign 0.09
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAGCCATTCCATCCATATC -3'
(R):5'- AGAGGCATTTTGTAATTACACAGGG -3'

Sequencing Primer
(F):5'- TTGCACATACAGCTTAGACAAAAG -3'
(R):5'- CACAGGGATTGATCTATTCTT -3'
Posted On2018-02-27