Incidental Mutation 'R6190:Ankhd1'
ID502525
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 044330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6190 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36611809 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 601 (S601A)
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006205
AA Change: S601A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: S601A

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136030
SMART Domains Protein: ENSMUSP00000115837
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 94 123 2.07e-2 SMART
ANK 127 156 2.48e-5 SMART
ANK 161 190 3.85e-2 SMART
ANK 194 219 4.23e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142780
Predicted Effect possibly damaging
Transcript: ENSMUST00000142977
AA Change: S601A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: S601A

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152060
AA Change: S29A
SMART Domains Protein: ENSMUSP00000116047
Gene: ENSMUSG00000024483
AA Change: S29A

DomainStartEndE-ValueType
ANK 1 28 1.6e1 SMART
ANK 32 61 4.56e-4 SMART
ANK 66 95 9.64e-3 SMART
ANK 99 128 6.71e-2 SMART
coiled coil region 227 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153606
Predicted Effect possibly damaging
Transcript: ENSMUST00000155329
AA Change: S601A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: S601A

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156424
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,605,608 L224Q probably damaging Het
Abcc5 A G 16: 20,392,779 M478T probably benign Het
Acot10 T C 15: 20,665,785 D290G possibly damaging Het
Actr3b A G 5: 25,831,690 Q167R probably benign Het
Actr8 C T 14: 29,991,717 R565* probably null Het
Adcy7 C T 8: 88,325,730 probably null Het
Adgrb3 C T 1: 25,420,647 V576I probably benign Het
Adgrv1 T A 13: 81,459,763 probably null Het
Adgrv1 A T 13: 81,524,779 probably null Het
Ak2 A G 4: 128,999,183 D45G probably damaging Het
Ak9 C G 10: 41,422,407 Q1489E unknown Het
Ak9 A T 10: 41,422,408 Q1489L unknown Het
Akap12 C A 10: 4,356,268 S1026Y possibly damaging Het
Apba2 A T 7: 64,739,880 E508V probably damaging Het
Arhgap18 A G 10: 26,846,035 M1V probably null Het
Arhgef10l G A 4: 140,542,762 T865M possibly damaging Het
Bdh1 T A 16: 31,449,897 V150D probably damaging Het
Becn1 A G 11: 101,295,374 C135R probably damaging Het
C2cd4d A G 3: 94,363,919 D164G probably benign Het
C87414 A T 5: 93,638,078 N114K probably benign Het
Cacna1e C A 1: 154,486,570 V424F possibly damaging Het
Capn7 C A 14: 31,363,603 T511K probably benign Het
Cdc5l G A 17: 45,408,017 P558S probably benign Het
Cep170 T A 1: 176,782,409 H112L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Clca3a1 A G 3: 144,758,060 V152A probably benign Het
Cnot10 G T 9: 114,632,723 T24K probably damaging Het
Cntnap5b T A 1: 100,379,075 I839N possibly damaging Het
Cyp4f13 A T 17: 32,929,873 D299E probably damaging Het
Dclk1 A G 3: 55,487,811 E128G probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dgcr8 T C 16: 18,284,410 T3A probably damaging Het
Dld A C 12: 31,344,848 I58S probably damaging Het
Dlg5 T A 14: 24,190,438 R248S probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Faf1 C T 4: 109,861,815 L373F probably damaging Het
Fam159a A T 4: 108,367,855 I170N probably damaging Het
Fam171b C T 2: 83,876,698 T304I probably benign Het
Fcgrt A T 7: 45,102,198 probably null Het
Gimap9 T C 6: 48,678,351 W291R probably damaging Het
Gm4847 G A 1: 166,630,323 A487V probably damaging Het
Gria4 T A 9: 4,420,199 I888F probably benign Het
Hapln2 T A 3: 88,023,293 I224F probably damaging Het
Herc1 T G 9: 66,376,381 L332R possibly damaging Het
Hmgxb4 T C 8: 75,023,299 V481A probably benign Het
Htr1d T C 4: 136,442,798 S113P probably damaging Het
Ift81 T C 5: 122,551,100 Q651R probably benign Het
Il17ra T C 6: 120,475,273 S199P probably damaging Het
Itih2 T C 2: 10,098,507 N723S probably benign Het
Jak1 A T 4: 101,175,128 V427E probably damaging Het
Krt23 C T 11: 99,485,758 D191N probably damaging Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Llgl2 G A 11: 115,846,986 R199Q probably benign Het
Lrrc37a G T 11: 103,501,216 Q1128K possibly damaging Het
Lrrc74a T C 12: 86,736,489 V36A probably benign Het
M1ap T A 6: 83,003,896 D254E possibly damaging Het
Mal2 C T 15: 54,571,398 probably benign Het
Mbnl2 A G 14: 120,385,421 T124A probably benign Het
Nfatc1 A G 18: 80,712,670 S33P probably benign Het
Nfkbid A G 7: 30,425,737 N253S probably damaging Het
Ngfr T A 11: 95,574,441 I194F probably benign Het
Nhsl1 A G 10: 18,470,041 probably benign Het
Nol9 T A 4: 152,041,234 I214N possibly damaging Het
Olfr1047 T A 2: 86,228,234 T246S possibly damaging Het
Olfr477 T C 7: 107,991,100 L245P probably damaging Het
Olfr98 A G 17: 37,262,744 S307P probably benign Het
Pax3 C T 1: 78,192,549 S160N possibly damaging Het
Pde3b A G 7: 114,523,032 probably null Het
Pde5a A C 3: 122,729,307 E21A probably benign Het
Plcxd1 A G 5: 110,102,603 E270G probably damaging Het
Plxna1 T A 6: 89,356,604 K348* probably null Het
Prpmp5 T A 6: 132,312,729 H44L unknown Het
Psg21 G T 7: 18,655,001 D55E possibly damaging Het
Rasa1 C A 13: 85,233,695 A493S probably benign Het
Raver2 A G 4: 101,133,617 I396V probably benign Het
Rpa2 A G 4: 132,775,020 K138E probably benign Het
Rsad1 T C 11: 94,548,236 N133D probably damaging Het
Rusc1 T C 3: 89,091,881 D198G probably benign Het
Samsn1 A T 16: 75,870,915 Y258N probably damaging Het
Scap A G 9: 110,374,067 N270D probably benign Het
Smpd4 T C 16: 17,632,013 Y200H probably damaging Het
Steap2 A G 5: 5,675,881 V381A probably damaging Het
Syk C T 13: 52,611,053 T72I probably damaging Het
Tbc1d14 T C 5: 36,571,884 D66G possibly damaging Het
Tcp11 A G 17: 28,071,717 Y223H probably benign Het
Timm9 A G 12: 71,126,350 S8P probably benign Het
Tmpo T C 10: 91,164,207 probably null Het
Vezf1 T C 11: 88,076,186 M81T probably benign Het
Vipr1 T A 9: 121,664,653 W257R probably damaging Het
Vmn1r237 G A 17: 21,314,294 G93D probably damaging Het
Vmn2r6 A G 3: 64,538,003 V678A probably benign Het
Vmn2r85 T C 10: 130,425,461 T336A possibly damaging Het
Xpnpep3 C A 15: 81,438,099 D296E probably benign Het
Zfp35 C A 18: 24,004,061 H487Q probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Zfp677 A G 17: 21,397,268 T196A possibly damaging Het
Zmym1 T C 4: 127,047,884 I904V probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
R7615:Ankhd1 UTSW 18 36656773 missense
R7654:Ankhd1 UTSW 18 36594101 missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36625205 missense probably damaging 1.00
RF001:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF004:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF007:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF008:Ankhd1 UTSW 18 36560924 small insertion probably benign
RF009:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF013:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF017:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF018:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF026:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560913 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF039:Ankhd1 UTSW 18 36560918 small insertion probably benign
RF043:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF046:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF049:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF050:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF054:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF057:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF060:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF061:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF062:Ankhd1 UTSW 18 36560918 small insertion probably benign
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCATGCTATCTAGTGTAACTG -3'
(R):5'- ACTGTTTGATGAAAAGACCCTCAAG -3'

Sequencing Primer
(F):5'- TCATGCTATCTAGTGTAACTGAAATG -3'
(R):5'- TCCAGTAATTATCTCACAAACTGTTG -3'
Posted On2018-02-27