Mutagenetix > Incidental Mutations

Incidental Mutation 'R6191:Uggt1'

502528

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

044331-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.666) question?

Stock #

R6191 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36162208 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1150 (N1150K)

Ref Sequence

ENSEMBL: ENSMUSP00000037930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046875
AA Change: N1150K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: N1150K

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173082

Predicted Effect

probably benign
Transcript: ENSMUST00000173166

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173999

Predicted Effect

probably benign
Transcript: ENSMUST00000174224

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Meta Mutation Damage Score

0.8734

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	C	9: 56,002,523	D144E	possibly damaging	Het
Amigo2	T	A	15: 97,245,538	K334N	probably benign	Het
Ano6	T	C	15: 95,948,499		probably null	Het
Ap1m2	C	A	9: 21,299,305	V343F	probably benign	Het
Apol6	T	C	15: 77,055,898	V307A	probably benign	Het
Arsi	C	A	18: 60,912,472	A78E	probably damaging	Het
B2m	A	T	2: 122,150,915	N37I	possibly damaging	Het
C8a	T	C	4: 104,845,903	K363R	probably benign	Het
Ccdc117	C	A	11: 5,534,242		probably null	Het
Ccdc154	C	A	17: 25,167,971	Q325K	probably damaging	Het
Cd300e	A	T	11: 115,054,533	V145E	possibly damaging	Het
Col19a1	G	T	1: 24,317,393	P673Q	probably damaging	Het
Csn2	A	G	5: 87,696,026		probably null	Het
Ctnna1	T	C	18: 35,174,355	V135A	probably damaging	Het
Dnah11	T	A	12: 118,190,897	D216V	probably benign	Het
Dnah12	A	G	14: 26,710,257	H410R	probably benign	Het
Dock2	C	T	11: 34,231,652	R1637H	possibly damaging	Het
Dspp	A	G	5: 104,177,348	N526D	unknown	Het
Frem2	T	C	3: 53,655,280	H602R	probably benign	Het
Galc	A	T	12: 98,252,034	H186Q	probably damaging	Het
Grina	T	C	15: 76,249,018	V262A	probably damaging	Het
Gse1	G	A	8: 120,553,803		probably null	Het
H2-Oa	C	A	17: 34,093,868	Q40K	probably damaging	Het
Hfm1	C	A	5: 106,886,553	D763Y	possibly damaging	Het
Hmcn2	T	A	2: 31,458,746	Y4925N	probably damaging	Het
Hs3st3b1	C	A	11: 63,889,203	R366L	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Itpr2	A	G	6: 146,328,335	V1221A	probably benign	Het
K230010J24Rik	T	C	15: 76,046,369		probably null	Het
Kdm6b	T	C	11: 69,406,758	N285S	probably benign	Het
Klk1b1	T	A	7: 43,970,657	N181K	probably damaging	Het
Kmt2a	C	A	9: 44,826,828		probably benign	Het
Lama5	T	A	2: 180,180,611	T2890S	probably damaging	Het
Lama5	T	C	2: 180,185,959	D2170G	probably damaging	Het
Lsm2	T	A	17: 34,982,155		probably benign	Het
Map3k5	G	T	10: 20,023,669	C232F	probably damaging	Het
Mapk9	T	G	11: 49,863,556	D45E	probably damaging	Het
Mpnd	T	C	17: 56,012,482	V315A	possibly damaging	Het
Msh2	A	G	17: 87,723,472	I926V	probably benign	Het
Mtcl1	C	T	17: 66,343,526	R1345H	probably damaging	Het
Nbeal2	A	G	9: 110,627,990		probably null	Het
Neo1	T	C	9: 58,889,029	D1205G	probably damaging	Het
Nhlrc2	A	G	19: 56,570,859	S259G	probably benign	Het
Nkain4	G	A	2: 180,936,003	P186L	probably damaging	Het
Nkain4	G	A	2: 180,936,004	P186S	probably damaging	Het
Nlrp1b	T	A	11: 71,218,457	R73*	probably null	Het
Nr5a2	T	C	1: 136,890,798	D330G	probably damaging	Het
Nup54	A	G	5: 92,424,294	L299P	probably damaging	Het
Olfr259	A	G	2: 87,107,952	V145A	probably damaging	Het
Olfr56	T	C	11: 49,135,050	L286P	probably damaging	Het
Pcdhb8	T	A	18: 37,356,226	V319E	probably benign	Het
Pcsk6	T	A	7: 65,929,127	D129E	probably benign	Het
Pld5	G	A	1: 175,970,534	T433I	probably benign	Het
Plin1	A	T	7: 79,721,599	L459H	probably benign	Het
Psd4	T	C	2: 24,394,487	V121A	probably damaging	Het
Pxdn	A	T	12: 29,982,717	I167F	possibly damaging	Het
R3hdm2	T	C	10: 127,484,515	S569P	probably damaging	Het
Rfng	T	A	11: 120,782,690	T202S	probably damaging	Het
Robo1	T	C	16: 72,933,808	S266P	probably benign	Het
Sema3c	G	T	5: 17,653,806	V68L	probably damaging	Het
Slco6c1	C	T	1: 97,066,083	R645H	possibly damaging	Het
Slfn8	A	G	11: 83,016,800	Y306H	possibly damaging	Het
Snap91	T	C	9: 86,838,052	D144G	probably damaging	Het
St7l	T	G	3: 104,868,033	F75C	probably damaging	Het
Stard10	A	G	7: 101,343,261	I145V	probably damaging	Het
Tekt3	C	T	11: 63,078,173	A242V	probably damaging	Het
Tex44	A	G	1: 86,426,584		probably benign	Het
Thg1l	T	C	11: 45,954,161	Q88R	probably benign	Het
Trav8n-2	T	A	14: 53,346,287	I67N	probably damaging	Het
Ttn	G	A	2: 76,847,426		probably benign	Het
Ube4a	A	T	9: 44,949,753	L253*	probably null	Het
Uhrf1bp1l	G	T	10: 89,805,318	G784C	possibly damaging	Het
Ush2a	T	A	1: 188,263,101	L23*	probably null	Het
Usp22	T	A	11: 61,174,776	N37I	probably benign	Het
Usp53	T	A	3: 122,949,741	K515N	probably damaging	Het
Vmn2r4	T	C	3: 64,415,281	K6E	probably benign	Het
Vps13d	C	T	4: 145,149,348	V1530M	probably damaging	Het
Vwa3b	A	G	1: 37,114,531	I485V	possibly damaging	Het
Wnk4	T	C	11: 101,264,330	Y356H	probably damaging	Het
Zcchc2	A	G	1: 105,990,170		probably benign	Het
Zfp345	A	C	2: 150,473,090	Y176D	probably benign	Het
Zfp598	T	C	17: 24,677,876	F238S	possibly damaging	Het
Zkscan17	T	C	11: 59,502,994	D10G	probably damaging	Het
Zmat4	T	G	8: 23,902,067	M13R	probably damaging	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTCATGAACTAGGTACTGAAC -3'
(R):5'- CTCTGGTCTTTCAGGTGGAC -3'

Sequencing Primer
(F):5'- CAAAGAGCCTCAGCAGGGC -3'
(R):5'- CAGGTGGACAGTATAGTGGCTGC -3'

Posted On

2018-02-27