Incidental Mutation 'R6191:C8a'
ID502549
Institutional Source Beutler Lab
Gene Symbol C8a
Ensembl Gene ENSMUSG00000035031
Gene Namecomplement component 8, alpha polypeptide
Synonyms
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6191 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location104815679-104876398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104845903 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 363 (K363R)
Ref Sequence ENSEMBL: ENSMUSP00000047606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048947] [ENSMUST00000064873] [ENSMUST00000106808]
Predicted Effect probably benign
Transcript: ENSMUST00000048947
AA Change: K363R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047606
Gene: ENSMUSG00000035031
AA Change: K363R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 3e-13 BLAST
Blast:TSP1 545 573 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000064873
AA Change: K363R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067541
Gene: ENSMUSG00000035031
AA Change: K363R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 4e-13 BLAST
TSP1 545 587 1.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106808
AA Change: K319R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102420
Gene: ENSMUSG00000035031
AA Change: K319R

DomainStartEndE-ValueType
Blast:TSP1 4 47 3e-15 BLAST
LDLa 51 88 2.07e-11 SMART
MACPF 244 448 5.26e-58 SMART
Blast:EGF 452 485 4e-13 BLAST
Blast:TSP1 501 543 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152146
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the alpha subunit, which associates with the beta and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the beta subunit. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dock2 C T 11: 34,231,652 R1637H possibly damaging Het
Dspp A G 5: 104,177,348 N526D unknown Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
Gse1 G A 8: 120,553,803 probably null Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Mtcl1 C T 17: 66,343,526 R1345H probably damaging Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
R3hdm2 T C 10: 127,484,515 S569P probably damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Wnk4 T C 11: 101,264,330 Y356H probably damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in C8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:C8a APN 4 104865445 intron probably benign
IGL01326:C8a APN 4 104856420 missense probably damaging 1.00
IGL01339:C8a APN 4 104827985 missense probably benign 0.00
IGL01809:C8a APN 4 104845942 missense probably benign 0.06
IGL01843:C8a APN 4 104862611 nonsense probably null
IGL01988:C8a APN 4 104826694 missense probably damaging 1.00
IGL02187:C8a APN 4 104862736 missense probably damaging 1.00
IGL02430:C8a APN 4 104817522 missense probably damaging 0.97
IGL02537:C8a APN 4 104845951 missense probably damaging 1.00
derogation UTSW 4 104828078 missense possibly damaging 0.50
insult UTSW 4 104828039 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0367:C8a UTSW 4 104862594 critical splice donor site probably null
R0632:C8a UTSW 4 104856492 missense probably damaging 1.00
R1013:C8a UTSW 4 104828039 missense probably benign 0.00
R1442:C8a UTSW 4 104828078 missense possibly damaging 0.50
R1902:C8a UTSW 4 104856601 critical splice acceptor site probably null
R2969:C8a UTSW 4 104853777 missense probably damaging 0.97
R3735:C8a UTSW 4 104817615 missense probably benign 0.43
R3736:C8a UTSW 4 104817615 missense probably benign 0.43
R4245:C8a UTSW 4 104876346 missense probably benign 0.00
R4707:C8a UTSW 4 104856421 missense probably damaging 1.00
R4812:C8a UTSW 4 104862591 splice site probably null
R5221:C8a UTSW 4 104845925 missense probably damaging 1.00
R5279:C8a UTSW 4 104845988 missense probably damaging 1.00
R5461:C8a UTSW 4 104815845 utr 3 prime probably benign
R5881:C8a UTSW 4 104853932 missense probably damaging 0.99
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6626:C8a UTSW 4 104845967 missense probably benign 0.01
R7438:C8a UTSW 4 104861429 missense probably damaging 0.97
R7471:C8a UTSW 4 104817625 missense probably benign 0.01
R7514:C8a UTSW 4 104846050 missense possibly damaging 0.94
R7596:C8a UTSW 4 104853867 missense possibly damaging 0.49
X0012:C8a UTSW 4 104826782 missense probably damaging 1.00
X0019:C8a UTSW 4 104817586 missense probably damaging 1.00
Z1176:C8a UTSW 4 104862686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGACACTAACAGCATGC -3'
(R):5'- ACAGACTGCACAGTTTAAGATGAG -3'

Sequencing Primer
(F):5'- GGAAAACTATCCCCTTGGTAGGATC -3'
(R):5'- TGAGAAGGAACAATATTGTGCTG -3'
Posted On2018-02-27