Incidental Mutation 'R6191:Dspp'
ID502554
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6191 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104177348 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 526 (N526D)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: N526D
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: N526D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
C8a T C 4: 104,845,903 K363R probably benign Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dock2 C T 11: 34,231,652 R1637H possibly damaging Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
Gse1 G A 8: 120,553,803 probably null Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Mtcl1 C T 17: 66,343,526 R1345H probably damaging Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
R3hdm2 T C 10: 127,484,515 S569P probably damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Wnk4 T C 11: 101,264,330 Y356H probably damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
R7390:Dspp UTSW 5 104175686 missense probably damaging 0.98
R7454:Dspp UTSW 5 104175610 missense probably benign 0.01
R7585:Dspp UTSW 5 104175525 missense possibly damaging 0.90
R7662:Dspp UTSW 5 104177870 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACTCTGAAAGCGCCAATGAG -3'
(R):5'- GTCGCTGCTGTCACTACTACTG -3'

Sequencing Primer
(F):5'- CCAATGAGAGTGGCAGCC -3'
(R):5'- GCTGTCGCTGCTGTCACTG -3'
Posted On2018-02-27