Incidental Mutation 'R6191:Gse1'
ID502562
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Namegenetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6191 (G1)
Quality Score201.009
Status Validated
Chromosome8
Chromosomal Location120228456-120581390 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 120553803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664] [ENSMUST00000180448]
Predicted Effect probably null
Transcript: ENSMUST00000034279
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118136
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120493
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180448
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
C8a T C 4: 104,845,903 K363R probably benign Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dock2 C T 11: 34,231,652 R1637H possibly damaging Het
Dspp A G 5: 104,177,348 N526D unknown Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Mtcl1 C T 17: 66,343,526 R1345H probably damaging Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
R3hdm2 T C 10: 127,484,515 S569P probably damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Wnk4 T C 11: 101,264,330 Y356H probably damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 120553587 start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 120575262 intron probably benign
IGL02931:Gse1 APN 8 120578069 intron probably benign
IGL03193:Gse1 APN 8 120571340 critical splice donor site probably null
R0027:Gse1 UTSW 8 120566546 intron probably benign
R0109:Gse1 UTSW 8 120567785 missense probably damaging 1.00
R0257:Gse1 UTSW 8 120572334 intron probably benign
R0967:Gse1 UTSW 8 120570855 intron probably benign
R1395:Gse1 UTSW 8 120574999 intron probably benign
R1480:Gse1 UTSW 8 120572394 intron probably benign
R1532:Gse1 UTSW 8 120568210 intron probably benign
R1649:Gse1 UTSW 8 120578515 intron probably benign
R1728:Gse1 UTSW 8 120568253 intron probably benign
R1742:Gse1 UTSW 8 120566950 missense probably damaging 1.00
R1784:Gse1 UTSW 8 120568253 intron probably benign
R2081:Gse1 UTSW 8 120566480 missense probably damaging 1.00
R2110:Gse1 UTSW 8 120566980 missense probably damaging 1.00
R2974:Gse1 UTSW 8 120570897 intron probably benign
R3615:Gse1 UTSW 8 120572742 intron probably benign
R3616:Gse1 UTSW 8 120572742 intron probably benign
R3857:Gse1 UTSW 8 120571133 intron probably benign
R4201:Gse1 UTSW 8 120567764 missense probably benign 0.39
R4494:Gse1 UTSW 8 120570814 intron probably benign
R4857:Gse1 UTSW 8 120572757 intron probably benign
R4911:Gse1 UTSW 8 120568466 intron probably benign
R5640:Gse1 UTSW 8 120562677 missense possibly damaging 0.65
R5782:Gse1 UTSW 8 120566521 missense probably damaging 1.00
R5980:Gse1 UTSW 8 120229637 intron probably benign
R6090:Gse1 UTSW 8 120571169 intron probably benign
R6156:Gse1 UTSW 8 120489127 missense possibly damaging 0.95
R6270:Gse1 UTSW 8 120569163 intron probably benign
R6502:Gse1 UTSW 8 120553689 unclassified probably null
R6573:Gse1 UTSW 8 120567797 missense probably damaging 1.00
R6885:Gse1 UTSW 8 120229482 intron probably benign
R6901:Gse1 UTSW 8 120229822 intron probably benign
R6959:Gse1 UTSW 8 120570971 intron probably benign
R7023:Gse1 UTSW 8 120230648 intron probably benign
R7210:Gse1 UTSW 8 120230702 missense unknown
R7263:Gse1 UTSW 8 120574171 missense unknown
R7449:Gse1 UTSW 8 120229711 missense unknown
R7602:Gse1 UTSW 8 120569304 missense unknown
R7627:Gse1 UTSW 8 120572777 missense unknown
R7635:Gse1 UTSW 8 120572895 missense unknown
R7689:Gse1 UTSW 8 120568478 missense unknown
X0026:Gse1 UTSW 8 120568163 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCCATGAGCCCAAGTC -3'
(R):5'- GGTATGATGACAGCTACACTTGACG -3'

Sequencing Primer
(F):5'- ATGCTTTCCACGGCGAC -3'
(R):5'- TGACAGCTACACTTGACGGCTAC -3'
Posted On2018-02-27