Mutagenetix > Incidental Mutations

Incidental Mutation 'R6191:Nbeal2'

502569

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

MMRRC Submission

044331-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.310) question?

Stock #

R6191 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 110627990 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035069] [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488] [ENSMUST00000196735] [ENSMUST00000196876]

Predicted Effect

probably benign
Transcript: ENSMUST00000035069

SMART Domains

Protein: ENSMUSP00000035069
Gene: ENSMUSG00000032491

Domain	Start	End	E-Value	Type
transmembrane domain	52	74	N/A	INTRINSIC
Pfam:Death	143	222	1.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126088

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129095

Predicted Effect

probably null
Transcript: ENSMUST00000130024

SMART Domains

Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	236	248	N/A	INTRINSIC
Pfam:DUF4704	345	607	2.5e-29	PFAM
low complexity region	649	664	N/A	INTRINSIC
low complexity region	804	819	N/A	INTRINSIC
Pfam:DUF4800	872	1138	9.9e-113	PFAM
low complexity region	1164	1193	N/A	INTRINSIC
Pfam:PH_BEACH	1204	1291	2.2e-21	PFAM
Beach	1343	1623	5.2e-205	SMART
WD40	1721	1766	1.03e1	SMART
WD40	1769	1808	6.19e-5	SMART
WD40	1820	1859	1.02e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000131017

SMART Domains

Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
Pfam:DUF4800	1	209	7.5e-97	PFAM
low complexity region	235	264	N/A	INTRINSIC
Pfam:PH_BEACH	275	362	1e-21	PFAM
Beach	414	694	5.2e-205	SMART
WD40	762	807	1.03e1	SMART
WD40	810	849	6.19e-5	SMART
WD40	861	900	1.02e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000133191

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138072

Predicted Effect

probably null
Transcript: ENSMUST00000167320

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000196488

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196735

SMART Domains

Protein: ENSMUSP00000143785
Gene: ENSMUSG00000032491

Domain	Start	End	E-Value	Type
transmembrane domain	52	74	N/A	INTRINSIC
Pfam:Death	143	200	2.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196876

SMART Domains

Protein: ENSMUSP00000142925
Gene: ENSMUSG00000032491

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197894

Meta Mutation Damage Score

0.9595

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	C	9: 56,002,523	D144E	possibly damaging	Het
Amigo2	T	A	15: 97,245,538	K334N	probably benign	Het
Ano6	T	C	15: 95,948,499		probably null	Het
Ap1m2	C	A	9: 21,299,305	V343F	probably benign	Het
Apol6	T	C	15: 77,055,898	V307A	probably benign	Het
Arsi	C	A	18: 60,912,472	A78E	probably damaging	Het
B2m	A	T	2: 122,150,915	N37I	possibly damaging	Het
C8a	T	C	4: 104,845,903	K363R	probably benign	Het
Ccdc117	C	A	11: 5,534,242		probably null	Het
Ccdc154	C	A	17: 25,167,971	Q325K	probably damaging	Het
Cd300e	A	T	11: 115,054,533	V145E	possibly damaging	Het
Col19a1	G	T	1: 24,317,393	P673Q	probably damaging	Het
Csn2	A	G	5: 87,696,026		probably null	Het
Ctnna1	T	C	18: 35,174,355	V135A	probably damaging	Het
Dnah11	T	A	12: 118,190,897	D216V	probably benign	Het
Dnah12	A	G	14: 26,710,257	H410R	probably benign	Het
Dock2	C	T	11: 34,231,652	R1637H	possibly damaging	Het
Dspp	A	G	5: 104,177,348	N526D	unknown	Het
Frem2	T	C	3: 53,655,280	H602R	probably benign	Het
Galc	A	T	12: 98,252,034	H186Q	probably damaging	Het
Grina	T	C	15: 76,249,018	V262A	probably damaging	Het
Gse1	G	A	8: 120,553,803		probably null	Het
H2-Oa	C	A	17: 34,093,868	Q40K	probably damaging	Het
Hfm1	C	A	5: 106,886,553	D763Y	possibly damaging	Het
Hmcn2	T	A	2: 31,458,746	Y4925N	probably damaging	Het
Hs3st3b1	C	A	11: 63,889,203	R366L	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Itpr2	A	G	6: 146,328,335	V1221A	probably benign	Het
K230010J24Rik	T	C	15: 76,046,369		probably null	Het
Kdm6b	T	C	11: 69,406,758	N285S	probably benign	Het
Klk1b1	T	A	7: 43,970,657	N181K	probably damaging	Het
Kmt2a	C	A	9: 44,826,828		probably benign	Het
Lama5	T	A	2: 180,180,611	T2890S	probably damaging	Het
Lama5	T	C	2: 180,185,959	D2170G	probably damaging	Het
Lsm2	T	A	17: 34,982,155		probably benign	Het
Map3k5	G	T	10: 20,023,669	C232F	probably damaging	Het
Mapk9	T	G	11: 49,863,556	D45E	probably damaging	Het
Mpnd	T	C	17: 56,012,482	V315A	possibly damaging	Het
Msh2	A	G	17: 87,723,472	I926V	probably benign	Het
Mtcl1	C	T	17: 66,343,526	R1345H	probably damaging	Het
Neo1	T	C	9: 58,889,029	D1205G	probably damaging	Het
Nhlrc2	A	G	19: 56,570,859	S259G	probably benign	Het
Nkain4	G	A	2: 180,936,003	P186L	probably damaging	Het
Nkain4	G	A	2: 180,936,004	P186S	probably damaging	Het
Nlrp1b	T	A	11: 71,218,457	R73*	probably null	Het
Nr5a2	T	C	1: 136,890,798	D330G	probably damaging	Het
Nup54	A	G	5: 92,424,294	L299P	probably damaging	Het
Olfr259	A	G	2: 87,107,952	V145A	probably damaging	Het
Olfr56	T	C	11: 49,135,050	L286P	probably damaging	Het
Pcdhb8	T	A	18: 37,356,226	V319E	probably benign	Het
Pcsk6	T	A	7: 65,929,127	D129E	probably benign	Het
Pld5	G	A	1: 175,970,534	T433I	probably benign	Het
Plin1	A	T	7: 79,721,599	L459H	probably benign	Het
Psd4	T	C	2: 24,394,487	V121A	probably damaging	Het
Pxdn	A	T	12: 29,982,717	I167F	possibly damaging	Het
R3hdm2	T	C	10: 127,484,515	S569P	probably damaging	Het
Rfng	T	A	11: 120,782,690	T202S	probably damaging	Het
Robo1	T	C	16: 72,933,808	S266P	probably benign	Het
Sema3c	G	T	5: 17,653,806	V68L	probably damaging	Het
Slco6c1	C	T	1: 97,066,083	R645H	possibly damaging	Het
Slfn8	A	G	11: 83,016,800	Y306H	possibly damaging	Het
Snap91	T	C	9: 86,838,052	D144G	probably damaging	Het
St7l	T	G	3: 104,868,033	F75C	probably damaging	Het
Stard10	A	G	7: 101,343,261	I145V	probably damaging	Het
Tekt3	C	T	11: 63,078,173	A242V	probably damaging	Het
Tex44	A	G	1: 86,426,584		probably benign	Het
Thg1l	T	C	11: 45,954,161	Q88R	probably benign	Het
Trav8n-2	T	A	14: 53,346,287	I67N	probably damaging	Het
Ttn	G	A	2: 76,847,426		probably benign	Het
Ube4a	A	T	9: 44,949,753	L253*	probably null	Het
Uggt1	A	T	1: 36,162,208	N1150K	probably damaging	Het
Uhrf1bp1l	G	T	10: 89,805,318	G784C	possibly damaging	Het
Ush2a	T	A	1: 188,263,101	L23*	probably null	Het
Usp22	T	A	11: 61,174,776	N37I	probably benign	Het
Usp53	T	A	3: 122,949,741	K515N	probably damaging	Het
Vmn2r4	T	C	3: 64,415,281	K6E	probably benign	Het
Vps13d	C	T	4: 145,149,348	V1530M	probably damaging	Het
Vwa3b	A	G	1: 37,114,531	I485V	possibly damaging	Het
Wnk4	T	C	11: 101,264,330	Y356H	probably damaging	Het
Zcchc2	A	G	1: 105,990,170		probably benign	Het
Zfp345	A	C	2: 150,473,090	Y176D	probably benign	Het
Zfp598	T	C	17: 24,677,876	F238S	possibly damaging	Het
Zkscan17	T	C	11: 59,502,994	D10G	probably damaging	Het
Zmat4	T	G	8: 23,902,067	M13R	probably damaging	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	intron	probably null
schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0310:Nbeal2	UTSW	9	110638163	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1519:Nbeal2	UTSW	9	110636305	missense	probably damaging	1.00
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R1997:Nbeal2	UTSW	9	110632198	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2113:Nbeal2	UTSW	9	110625406	missense	probably damaging	1.00
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R4991:Nbeal2	UTSW	9	110638767	missense	probably damaging	1.00
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7099:Nbeal2	UTSW	9	110645438	intron	probably null
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
R7902:Nbeal2	UTSW	9	110637547	missense	probably benign
R7985:Nbeal2	UTSW	9	110637547	missense	probably benign
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- GACGTGTGGCTAAACCCATC -3'
(R):5'- CTTACGAAGGTAGGCAGTGTGC -3'

Sequencing Primer
(F):5'- GTGTGGCTAAACCCATCTTACAC -3'
(R):5'- TGTGCCGCACGTGAGATG -3'

Posted On

2018-02-27