Incidental Mutation 'R6191:R3hdm2'
ID502572
Institutional Source Beutler Lab
Gene Symbol R3hdm2
Ensembl Gene ENSMUSG00000025404
Gene NameR3H domain containing 2
Synonyms
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R6191 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127380327-127499384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127484515 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 569 (S569P)
Ref Sequence ENSEMBL: ENSMUSP00000100886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000168079] [ENSMUST00000169888] [ENSMUST00000170336]
Predicted Effect probably benign
Transcript: ENSMUST00000064793
AA Change: S542P

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404
AA Change: S542P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077046
AA Change: S587P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404
AA Change: S587P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105249
AA Change: S535P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404
AA Change: S535P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105250
AA Change: S569P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404
AA Change: S569P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105251
AA Change: S569P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404
AA Change: S569P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164469
Predicted Effect probably damaging
Transcript: ENSMUST00000164831
AA Change: S521P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404
AA Change: S521P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166820
AA Change: S587P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404
AA Change: S587P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168079
SMART Domains Protein: ENSMUSP00000130506
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168268
Predicted Effect probably damaging
Transcript: ENSMUST00000169888
AA Change: S286P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404
AA Change: S286P

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170336
AA Change: S555P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404
AA Change: S555P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171823
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
C8a T C 4: 104,845,903 K363R probably benign Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dock2 C T 11: 34,231,652 R1637H possibly damaging Het
Dspp A G 5: 104,177,348 N526D unknown Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
Gse1 G A 8: 120,553,803 probably null Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Mtcl1 C T 17: 66,343,526 R1345H probably damaging Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Wnk4 T C 11: 101,264,330 Y356H probably damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in R3hdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:R3hdm2 APN 10 127458850 missense probably damaging 1.00
IGL02114:R3hdm2 APN 10 127484109 missense probably damaging 0.99
IGL02116:R3hdm2 APN 10 127498552 missense probably damaging 1.00
IGL02549:R3hdm2 APN 10 127484225 splice site probably benign
IGL02647:R3hdm2 APN 10 127459484 missense probably damaging 1.00
IGL02696:R3hdm2 APN 10 127465019 splice site probably null
IGL02732:R3hdm2 APN 10 127484060 missense probably benign 0.43
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0132:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0157:R3hdm2 UTSW 10 127471989 missense probably damaging 0.99
R0179:R3hdm2 UTSW 10 127495106 missense probably damaging 1.00
R0196:R3hdm2 UTSW 10 127484521 missense probably damaging 1.00
R0401:R3hdm2 UTSW 10 127458173 missense possibly damaging 0.90
R0505:R3hdm2 UTSW 10 127457700 missense probably damaging 1.00
R0606:R3hdm2 UTSW 10 127444444 missense probably damaging 1.00
R1188:R3hdm2 UTSW 10 127452755 missense probably benign 0.02
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1503:R3hdm2 UTSW 10 127471826 nonsense probably null
R1584:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1652:R3hdm2 UTSW 10 127495091 missense probably benign 0.00
R1901:R3hdm2 UTSW 10 127498468 missense possibly damaging 0.91
R3735:R3hdm2 UTSW 10 127465010 missense probably benign
R5261:R3hdm2 UTSW 10 127498416 missense probably damaging 1.00
R5329:R3hdm2 UTSW 10 127458893 missense probably damaging 1.00
R5379:R3hdm2 UTSW 10 127471902 missense probably damaging 1.00
R5380:R3hdm2 UTSW 10 127485447 missense probably damaging 1.00
R5387:R3hdm2 UTSW 10 127485434 missense probably damaging 1.00
R5558:R3hdm2 UTSW 10 127444402 missense probably damaging 1.00
R5773:R3hdm2 UTSW 10 127444303 utr 5 prime probably benign
R5936:R3hdm2 UTSW 10 127471812 missense probably damaging 1.00
R6024:R3hdm2 UTSW 10 127459480 missense probably damaging 1.00
R6160:R3hdm2 UTSW 10 127484507 missense probably damaging 1.00
R7058:R3hdm2 UTSW 10 127484513 missense probably damaging 1.00
R7224:R3hdm2 UTSW 10 127458153 missense probably damaging 1.00
R7253:R3hdm2 UTSW 10 127481775 missense probably damaging 1.00
R7305:R3hdm2 UTSW 10 127476678 missense probably benign 0.08
R7349:R3hdm2 UTSW 10 127492646 missense probably benign
R7431:R3hdm2 UTSW 10 127458147 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACAGCAGTGGTGGTTTATTTC -3'
(R):5'- AGATTCCGGCCCCTTCTTAG -3'

Sequencing Primer
(F):5'- GGTTTATTTCAGACCTGTACAGTCAC -3'
(R):5'- CCGGCCCCTTCTTAGAAAGTTAATAG -3'
Posted On2018-02-27