Incidental Mutation 'R6191:Mtcl1'
ID502603
Institutional Source Beutler Lab
Gene Symbol Mtcl1
Ensembl Gene ENSMUSG00000052105
Gene Namemicrotubule crosslinking factor 1
SynonymsSoga2, t8219b25, 1110012J17Rik
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6191 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location66336982-66449750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66343526 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1345 (R1345H)
Ref Sequence ENSEMBL: ENSMUSP00000135690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086693] [ENSMUST00000097291] [ENSMUST00000145347] [ENSMUST00000177034]
Predicted Effect probably damaging
Transcript: ENSMUST00000086693
AA Change: R1648H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083899
Gene: ENSMUSG00000052105
AA Change: R1648H

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 493 587 1.8e-34 PFAM
Pfam:DUF3166 622 714 3.8e-39 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1344 3e-40 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
low complexity region 1912 1924 N/A INTRINSIC
low complexity region 1931 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097291
AA Change: R1648H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094894
Gene: ENSMUSG00000052105
AA Change: R1648H

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 492 588 1.8e-43 PFAM
Pfam:DUF3166 621 716 5e-19 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1392 3.9e-49 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134139
Predicted Effect probably damaging
Transcript: ENSMUST00000145347
AA Change: R1199H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121387
Gene: ENSMUSG00000052105
AA Change: R1199H

DomainStartEndE-ValueType
Pfam:DUF3166 43 139 9.1e-44 PFAM
Pfam:DUF3166 172 267 2.5e-19 PFAM
low complexity region 394 410 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 600 613 N/A INTRINSIC
coiled coil region 671 710 N/A INTRINSIC
Pfam:DUF4482 771 910 4.6e-49 PFAM
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1223 1232 N/A INTRINSIC
low complexity region 1463 1475 N/A INTRINSIC
low complexity region 1482 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177034
AA Change: R1345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135690
Gene: ENSMUSG00000052105
AA Change: R1345H

DomainStartEndE-ValueType
Pfam:DUF3166 140 236 1.5e-43 PFAM
Pfam:DUF3166 269 364 4e-19 PFAM
low complexity region 491 507 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
coiled coil region 642 674 N/A INTRINSIC
low complexity region 738 751 N/A INTRINSIC
coiled coil region 809 848 N/A INTRINSIC
Pfam:DUF4482 909 1042 4e-49 PFAM
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1369 1378 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Global or Purkinje cell-specific homozygous knockout affects Purkinje cell axon and dendrite morphology, resulting in abnormal motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
C8a T C 4: 104,845,903 K363R probably benign Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dock2 C T 11: 34,231,652 R1637H possibly damaging Het
Dspp A G 5: 104,177,348 N526D unknown Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
Gse1 G A 8: 120,553,803 probably null Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
R3hdm2 T C 10: 127,484,515 S569P probably damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Wnk4 T C 11: 101,264,330 Y356H probably damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in Mtcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Mtcl1 APN 17 66344319 missense probably benign 0.00
IGL01774:Mtcl1 APN 17 66385885 missense probably damaging 1.00
IGL01918:Mtcl1 APN 17 66368268 missense possibly damaging 0.47
IGL02000:Mtcl1 APN 17 66354190 missense probably benign 0.19
IGL02074:Mtcl1 APN 17 66366468 missense possibly damaging 0.68
IGL02338:Mtcl1 APN 17 66379970 missense probably damaging 1.00
IGL02597:Mtcl1 APN 17 66338021 missense probably benign
IGL03034:Mtcl1 APN 17 66344198 missense probably damaging 1.00
IGL03120:Mtcl1 APN 17 66379383 missense probably damaging 0.96
IGL03184:Mtcl1 APN 17 66354214 missense probably benign 0.01
IGL03240:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03294:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03332:Mtcl1 APN 17 66338019 missense probably damaging 1.00
PIT4378001:Mtcl1 UTSW 17 66438279 missense probably damaging 1.00
PIT4520001:Mtcl1 UTSW 17 66385912 missense possibly damaging 0.48
R0110:Mtcl1 UTSW 17 66358114 missense possibly damaging 0.51
R0113:Mtcl1 UTSW 17 66354242 missense possibly damaging 0.52
R0321:Mtcl1 UTSW 17 66379431 missense probably damaging 1.00
R0366:Mtcl1 UTSW 17 66338129 missense probably damaging 1.00
R0629:Mtcl1 UTSW 17 66338142 missense possibly damaging 0.89
R1466:Mtcl1 UTSW 17 66380435 missense probably damaging 1.00
R1467:Mtcl1 UTSW 17 66448327 missense probably damaging 1.00
R1471:Mtcl1 UTSW 17 66379148 missense probably damaging 0.96
R1650:Mtcl1 UTSW 17 66385876 missense probably damaging 1.00
R1754:Mtcl1 UTSW 17 66380183 missense probably damaging 1.00
R1855:Mtcl1 UTSW 17 66379514 missense probably benign
R1882:Mtcl1 UTSW 17 66379320 missense probably benign 0.01
R1935:Mtcl1 UTSW 17 66379414 missense probably benign 0.10
R2063:Mtcl1 UTSW 17 66346355 missense probably damaging 1.00
R2132:Mtcl1 UTSW 17 66343623 missense probably benign 0.04
R2197:Mtcl1 UTSW 17 66366432 missense probably benign
R3196:Mtcl1 UTSW 17 66343834 missense probably benign 0.07
R3877:Mtcl1 UTSW 17 66342954 missense probably damaging 1.00
R4116:Mtcl1 UTSW 17 66366481 missense probably benign
R4204:Mtcl1 UTSW 17 66438261 missense probably damaging 1.00
R4373:Mtcl1 UTSW 17 66380079 missense probably benign 0.05
R4396:Mtcl1 UTSW 17 66344225 missense probably damaging 1.00
R4591:Mtcl1 UTSW 17 66348511 missense probably benign 0.07
R4610:Mtcl1 UTSW 17 66377887 missense probably benign 0.04
R4681:Mtcl1 UTSW 17 66449144 missense unknown
R4922:Mtcl1 UTSW 17 66348479 missense probably benign 0.29
R4992:Mtcl1 UTSW 17 66342839 missense probably damaging 0.99
R5169:Mtcl1 UTSW 17 66343823 missense probably benign 0.00
R5542:Mtcl1 UTSW 17 66384359 intron probably benign
R5804:Mtcl1 UTSW 17 66343137 missense probably benign 0.03
R5998:Mtcl1 UTSW 17 66368280 missense probably damaging 0.99
R6163:Mtcl1 UTSW 17 66379331 missense probably benign 0.10
R6254:Mtcl1 UTSW 17 66358134 missense probably benign 0.02
R6260:Mtcl1 UTSW 17 66343541 missense probably damaging 1.00
R6524:Mtcl1 UTSW 17 66348285 missense probably benign 0.15
R6884:Mtcl1 UTSW 17 66438202 missense probably damaging 1.00
R7199:Mtcl1 UTSW 17 66340539 missense probably benign 0.13
R7431:Mtcl1 UTSW 17 66342906 nonsense probably null
R7479:Mtcl1 UTSW 17 66379490 missense probably benign
R7564:Mtcl1 UTSW 17 66371327 missense probably benign
R7608:Mtcl1 UTSW 17 66343305 missense probably damaging 0.96
R7691:Mtcl1 UTSW 17 66380357 missense probably damaging 1.00
R7847:Mtcl1 UTSW 17 66344333 missense probably damaging 0.96
R7908:Mtcl1 UTSW 17 66371330 missense possibly damaging 0.80
R7930:Mtcl1 UTSW 17 66344333 missense probably damaging 0.96
R7989:Mtcl1 UTSW 17 66371330 missense possibly damaging 0.80
X0065:Mtcl1 UTSW 17 66379607 missense probably damaging 1.00
Z1088:Mtcl1 UTSW 17 66343728 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCTGCTATTTGGCTGGTCAG -3'
(R):5'- GTCTAAGAACATGAGTGATGACATG -3'

Sequencing Primer
(F):5'- CTCTGAAGTTTGGGAGAACCGTAC -3'
(R):5'- ACATGAAGGAGGTGGCTTTTTC -3'
Posted On2018-02-27