Incidental Mutation 'R6192:Mrps5'
ID 502622
Institutional Source Beutler Lab
Gene Symbol Mrps5
Ensembl Gene ENSMUSG00000027374
Gene Name mitochondrial ribosomal protein S5
Synonyms
MMRRC Submission 044332-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6192 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127587222-127606829 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127601385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 294 (H294Q)
Ref Sequence ENSEMBL: ENSMUSP00000028852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028852]
AlphaFold Q99N87
Predicted Effect probably damaging
Transcript: ENSMUST00000028852
AA Change: H294Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: H294Q

DomainStartEndE-ValueType
low complexity region 108 126 N/A INTRINSIC
Pfam:Ribosomal_S5 220 285 3.5e-20 PFAM
Pfam:Ribosomal_S5_C 297 368 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145271
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Col4a4 G T 1: 82,484,430 P1075T probably damaging Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Ddx20 T C 3: 105,678,720 T770A probably benign Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Muc16 A T 9: 18,658,689 S845T unknown Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sbno2 A T 10: 80,060,016 L977Q probably damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Spag8 A G 4: 43,652,458 F294S probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Vmn2r4 A T 3: 64,415,278 C7S probably benign Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Mrps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Mrps5 APN 2 127591907 missense probably null 0.01
IGL03348:Mrps5 APN 2 127601385 missense probably damaging 0.98
R0369:Mrps5 UTSW 2 127591829 missense probably benign 0.09
R0485:Mrps5 UTSW 2 127591825 missense possibly damaging 0.56
R0622:Mrps5 UTSW 2 127594531 missense probably benign 0.00
R1954:Mrps5 UTSW 2 127596897 splice site probably null
R2182:Mrps5 UTSW 2 127602487 missense probably damaging 1.00
R3414:Mrps5 UTSW 2 127596912 missense probably benign 0.38
R4007:Mrps5 UTSW 2 127591835 missense possibly damaging 0.81
R4687:Mrps5 UTSW 2 127590770 missense probably benign 0.44
R4780:Mrps5 UTSW 2 127598241 missense probably benign 0.00
R4835:Mrps5 UTSW 2 127603707 missense possibly damaging 0.84
R4851:Mrps5 UTSW 2 127590745 missense probably benign 0.00
R5076:Mrps5 UTSW 2 127600852 nonsense probably null
R5558:Mrps5 UTSW 2 127602435 missense probably damaging 1.00
R7038:Mrps5 UTSW 2 127600866 missense probably damaging 1.00
R7071:Mrps5 UTSW 2 127600852 nonsense probably null
R7103:Mrps5 UTSW 2 127601410 missense probably damaging 0.99
R7177:Mrps5 UTSW 2 127595697 missense probably benign
R7319:Mrps5 UTSW 2 127595842 missense possibly damaging 0.94
R7387:Mrps5 UTSW 2 127600884 missense probably damaging 1.00
R7460:Mrps5 UTSW 2 127591891 missense not run
R8211:Mrps5 UTSW 2 127603724 missense probably benign
R9358:Mrps5 UTSW 2 127595814 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTGCAGACTGTGTCACAAGATG -3'
(R):5'- GTGGTTATACTGCCAGCTCC -3'

Sequencing Primer
(F):5'- CAGACTGTGTCACAAGATGTTTTTG -3'
(R):5'- GCCAGCTCCGTCAACTTGAC -3'
Posted On 2018-02-27