Incidental Mutation 'R6192:Vmn2r4'
ID502625
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission 044332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6192 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64415278 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 7 (C7S)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175724]
Predicted Effect probably benign
Transcript: ENSMUST00000175724
AA Change: C7S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: C7S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Col4a4 G T 1: 82,484,430 P1075T probably damaging Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Ddx20 T C 3: 105,678,720 T770A probably benign Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Mrps5 T A 2: 127,601,385 H294Q probably damaging Het
Muc16 A T 9: 18,658,689 S845T unknown Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sbno2 A T 10: 80,060,016 L977Q probably damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Spag8 A G 4: 43,652,458 F294S probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTTGTTGGCATGGTCC -3'
(R):5'- CTAAAAGTGTTGCTCAGCTCC -3'

Sequencing Primer
(F):5'- GTTGGCATGGTCCTATAATGAACAG -3'
(R):5'- AAAAGTGTTGCTCAGCTCCTATTC -3'
Posted On2018-02-27