Incidental Mutation 'R6192:Ddx20'
ID502628
Institutional Source Beutler Lab
Gene Symbol Ddx20
Ensembl Gene ENSMUSG00000027905
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 20
SynonymsGEMIN3, dp103
MMRRC Submission 044332-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6192 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location105678270-105687574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105678720 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 770 (T770A)
Ref Sequence ENSEMBL: ENSMUSP00000088176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090680] [ENSMUST00000098761] [ENSMUST00000200078]
Predicted Effect probably benign
Transcript: ENSMUST00000090680
AA Change: T770A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088176
Gene: ENSMUSG00000027905
AA Change: T770A

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
DEXDc 82 280 7.47e-44 SMART
HELICc 324 405 2.8e-25 SMART
low complexity region 434 445 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098761
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132008
Predicted Effect probably benign
Transcript: ENSMUST00000200078
SMART Domains Protein: ENSMUSP00000142675
Gene: ENSMUSG00000027905

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
Pfam:DEAD 87 134 7.6e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to implant and develop past the 2-cell stage. Heterozygous null females are viable, healthy and fertile but show increased ovary weight, a greater number of empty follicles, a prolonged estrous phase, and reduced nocturnal and stress-induced serum ACTH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Col4a4 G T 1: 82,484,430 P1075T probably damaging Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Mrps5 T A 2: 127,601,385 H294Q probably damaging Het
Muc16 A T 9: 18,658,689 S845T unknown Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sbno2 A T 10: 80,060,016 L977Q probably damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Spag8 A G 4: 43,652,458 F294S probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Vmn2r4 A T 3: 64,415,278 C7S probably benign Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Ddx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ddx20 APN 3 105686670 missense probably damaging 1.00
IGL01832:Ddx20 APN 3 105679011 missense probably damaging 0.99
IGL02072:Ddx20 APN 3 105680627 missense probably damaging 1.00
IGL02821:Ddx20 APN 3 105679277 missense probably benign 0.00
R0520:Ddx20 UTSW 3 105687376 missense probably benign
R0600:Ddx20 UTSW 3 105679080 missense probably damaging 1.00
R1648:Ddx20 UTSW 3 105679188 missense probably benign 0.08
R1817:Ddx20 UTSW 3 105678580 nonsense probably null
R1843:Ddx20 UTSW 3 105679082 missense probably benign 0.00
R1922:Ddx20 UTSW 3 105678584 missense probably damaging 1.00
R1955:Ddx20 UTSW 3 105679562 missense possibly damaging 0.79
R1993:Ddx20 UTSW 3 105679344 nonsense probably null
R2215:Ddx20 UTSW 3 105680340 splice site probably benign
R2241:Ddx20 UTSW 3 105683205 nonsense probably null
R2315:Ddx20 UTSW 3 105678699 missense probably damaging 1.00
R4156:Ddx20 UTSW 3 105678933 missense probably benign 0.41
R4790:Ddx20 UTSW 3 105683169 missense probably benign 0.02
R4962:Ddx20 UTSW 3 105680605 missense possibly damaging 0.95
R5072:Ddx20 UTSW 3 105682875 critical splice donor site probably null
R5361:Ddx20 UTSW 3 105683509 missense probably damaging 0.96
R5622:Ddx20 UTSW 3 105679011 missense probably damaging 0.99
R5936:Ddx20 UTSW 3 105680587 missense possibly damaging 0.96
R6007:Ddx20 UTSW 3 105683420 missense possibly damaging 0.68
R6916:Ddx20 UTSW 3 105680613 missense probably damaging 1.00
R6957:Ddx20 UTSW 3 105684310 missense probably benign 0.30
R6970:Ddx20 UTSW 3 105680358 missense probably damaging 1.00
R8366:Ddx20 UTSW 3 105687379 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTGACAGTCACTAGTCTGAAGC -3'
(R):5'- TGATACCCCGACTCAAGTGG -3'

Sequencing Primer
(F):5'- TGACAGTCACTAGTCTGAAGCACATG -3'
(R):5'- TGGAGTATCAAGAAGCCCCTG -3'
Posted On2018-02-27