Incidental Mutation 'R6192:Spag8'
ID502633
Institutional Source Beutler Lab
Gene Symbol Spag8
Ensembl Gene ENSMUSG00000066196
Gene Namesperm associated antigen 8
Synonyms
MMRRC Submission 044332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6192 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43651335-43653594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43652458 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 294 (F294S)
Ref Sequence ENSEMBL: ENSMUSP00000103502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000030192] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030192
SMART Domains Protein: ENSMUSP00000030192
Gene: ENSMUSG00000028470

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DcpS_C 53 159 7.1e-25 PFAM
Pfam:HIT 61 158 1.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084646
AA Change: F294S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196
AA Change: F294S

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107870
AA Change: F294S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196
AA Change: F294S

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Col4a4 G T 1: 82,484,430 P1075T probably damaging Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Ddx20 T C 3: 105,678,720 T770A probably benign Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Mrps5 T A 2: 127,601,385 H294Q probably damaging Het
Muc16 A T 9: 18,658,689 S845T unknown Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sbno2 A T 10: 80,060,016 L977Q probably damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Vmn2r4 A T 3: 64,415,278 C7S probably benign Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Spag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Spag8 APN 4 43652890 nonsense probably null
IGL01766:Spag8 APN 4 43653209 unclassified probably benign
IGL02043:Spag8 APN 4 43653134 unclassified probably benign
IGL02324:Spag8 APN 4 43651781 missense probably damaging 1.00
IGL02812:Spag8 APN 4 43651755 missense probably damaging 0.96
IGL03336:Spag8 APN 4 43652114 splice site probably benign
R1519:Spag8 UTSW 4 43652777 missense possibly damaging 0.88
R1799:Spag8 UTSW 4 43653087 unclassified probably benign
R1799:Spag8 UTSW 4 43653345 unclassified probably benign
R2212:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R2338:Spag8 UTSW 4 43652826 missense probably benign 0.06
R3412:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R3413:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R3414:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R4666:Spag8 UTSW 4 43653408 unclassified probably benign
R4670:Spag8 UTSW 4 43653378 unclassified probably benign
R4745:Spag8 UTSW 4 43651636 missense probably damaging 0.98
R4795:Spag8 UTSW 4 43652035 missense possibly damaging 0.55
R5409:Spag8 UTSW 4 43653134 unclassified probably benign
R5992:Spag8 UTSW 4 43651534 missense probably benign 0.06
R6333:Spag8 UTSW 4 43653186 unclassified probably benign
R7216:Spag8 UTSW 4 43652034 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTTTGCCCTTATAGCCACCAAAC -3'
(R):5'- AGGTATGAAGAGGTCTGCCC -3'

Sequencing Primer
(F):5'- ACCAGGAAGTCCGGTCTC -3'
(R):5'- AGGTCTGCCCTCTCTTCCTAAGG -3'
Posted On2018-02-27