Incidental Mutation 'R6192:Muc16'
ID502654
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission 044332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6192 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18658689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 845 (S845T)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: S845T
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Col4a4 G T 1: 82,484,430 P1075T probably damaging Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Ddx20 T C 3: 105,678,720 T770A probably benign Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Mrps5 T A 2: 127,601,385 H294Q probably damaging Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sbno2 A T 10: 80,060,016 L977Q probably damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Spag8 A G 4: 43,652,458 F294S probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Vmn2r4 A T 3: 64,415,278 C7S probably benign Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCATGCTGTCCTCAAGG -3'
(R):5'- AAGAACTCCAGATGAGGCAC -3'

Sequencing Primer
(F):5'- TGTCCTCAAGGGGAAAGATATACCTC -3'
(R):5'- TGCCAATGCAGACAGATACAG -3'
Posted On2018-02-27