Incidental Mutation 'R6192:Sbno2'
ID502659
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission 044332-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R6192 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80060016 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 977 (L977Q)
Ref Sequence ENSEMBL: ENSMUSP00000151854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]
AlphaFold Q7TNB8
Predicted Effect probably damaging
Transcript: ENSMUST00000042771
AA Change: L977Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: L977Q

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097227
SMART Domains Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:GSHPx 97 204 6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105372
SMART Domains Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:GSHPx 41 148 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154095
Predicted Effect probably benign
Transcript: ENSMUST00000183037
SMART Domains Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
Pfam:GSHPx 1 108 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217876
Predicted Effect probably benign
Transcript: ENSMUST00000217972
Predicted Effect probably damaging
Transcript: ENSMUST00000218630
AA Change: L977Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219260
AA Change: L977Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.8935 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Col4a4 G T 1: 82,484,430 P1075T probably damaging Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Ddx20 T C 3: 105,678,720 T770A probably benign Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Mrps5 T A 2: 127,601,385 H294Q probably damaging Het
Muc16 A T 9: 18,658,689 S845T unknown Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Spag8 A G 4: 43,652,458 F294S probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Vmn2r4 A T 3: 64,415,278 C7S probably benign Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
psychopomp UTSW 10 80060016 missense probably damaging 0.99
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
R7746:Sbno2 UTSW 10 80058874 missense probably damaging 0.99
R7964:Sbno2 UTSW 10 80068351 missense probably damaging 1.00
R8055:Sbno2 UTSW 10 80069431 missense possibly damaging 0.81
R8221:Sbno2 UTSW 10 80070011 missense probably benign
R8329:Sbno2 UTSW 10 80064387 missense probably damaging 1.00
R8725:Sbno2 UTSW 10 80075256 missense probably benign 0.09
R8727:Sbno2 UTSW 10 80075256 missense probably benign 0.09
R8840:Sbno2 UTSW 10 80057526 missense probably damaging 0.97
R8932:Sbno2 UTSW 10 80062208 missense probably damaging 1.00
R8954:Sbno2 UTSW 10 80057962 missense probably damaging 1.00
R9003:Sbno2 UTSW 10 80060215 missense probably damaging 1.00
R9034:Sbno2 UTSW 10 80062757 missense probably damaging 1.00
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CATAACAGACACAGTGGGCC -3'
(R):5'- TTCCCTCGCAGACATGAAG -3'

Sequencing Primer
(F):5'- ACACAGTGGGCCTCAGATG -3'
(R):5'- CCTGCTGTCTGTGGGCATC -3'
Posted On2018-02-27