Mutagenetix > Incidental Mutation

Incidental Mutation 'R6192:Pdzrn4'

502672

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

044332-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R6192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92757681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 485 (E485V)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035399
AA Change: E246V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E246V

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: E485V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E485V

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.1919

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (75/75)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,988,169	T2768I	probably benign	Het
Adamts9	T	C	6: 92,797,021	E1137G	probably damaging	Het
Adcy9	T	C	16: 4,287,954	I1099V	probably benign	Het
Angptl4	A	T	17: 33,777,041	N320K	probably benign	Het
Atp6v0a2	G	A	5: 124,629,203	M10I	probably benign	Het
Cbfa2t3	A	G	8: 122,634,396	S395P	probably benign	Het
Cenpe	C	T	3: 135,248,530	T1716I	possibly damaging	Het
Chsy1	T	C	7: 66,170,877	Y287H	probably benign	Het
Col4a4	G	T	1: 82,484,430	P1075T	probably damaging	Het
Cryab	T	A	9: 50,754,513	M68K	probably damaging	Het
Cybrd1	T	A	2: 71,137,514	L143Q	probably null	Het
Dcaf7	T	C	11: 106,051,758	V177A	probably damaging	Het
Dclk2	T	C	3: 86,815,150	Y392C	probably damaging	Het
Ddx20	T	C	3: 105,678,720	T770A	probably benign	Het
Dennd1b	T	A	1: 139,167,718	D501E	probably benign	Het
Dgkh	A	T	14: 78,628,064	Y26*	probably null	Het
Dnajc2	A	G	5: 21,768,648	V196A	probably damaging	Het
Etl4	A	G	2: 20,801,551	K827E	probably damaging	Het
Fam8a1	C	T	13: 46,669,623	P13L	probably damaging	Het
Gfra3	T	C	18: 34,704,529	S139G	possibly damaging	Het
Ggnbp1	G	A	17: 27,029,873	V139I	possibly damaging	Het
Gja1	T	A	10: 56,388,234	Y230N	probably damaging	Het
Gldc	A	G	19: 30,133,772	S535P	probably damaging	Het
Gm45871	A	G	18: 90,592,233	T532A	probably benign	Het
Gm5431	T	A	11: 48,894,393	D107V	probably benign	Het
Herc2	C	T	7: 56,207,762	T4031M	probably damaging	Het
Iffo2	G	A	4: 139,606,458	A282T	probably damaging	Het
Ifi44	T	G	3: 151,745,639		probably null	Het
Igkv4-53	C	T	6: 69,648,931	R62H	possibly damaging	Het
Lrp11	A	C	10: 7,598,690		probably null	Het
Lrp4	A	G	2: 91,508,488	T1755A	probably benign	Het
Mcm3ap	A	T	10: 76,501,100	K1316M	probably damaging	Het
Mctp1	T	G	13: 76,822,963		probably null	Het
Mroh5	A	T	15: 73,790,781	I396N	probably damaging	Het
Mrps5	T	A	2: 127,601,385	H294Q	probably damaging	Het
Muc16	A	T	9: 18,658,689	S845T	unknown	Het
Mycbpap	A	T	11: 94,507,731	V474E	probably damaging	Het
Mzt2	G	C	16: 15,848,687	S122W	probably benign	Het
Neb	T	C	2: 52,256,790	I2821V	probably benign	Het
Ngef	A	T	1: 87,487,900	D347E	probably damaging	Het
Nlrp14	T	C	7: 107,182,439	V281A	probably benign	Het
Obscn	A	T	11: 58,998,038	Y7597N	unknown	Het
Olfr1297	T	C	2: 111,621,175	R300G	possibly damaging	Het
Patj	G	T	4: 98,456,157	G569W	probably damaging	Het
Phf2	T	A	13: 48,820,107	T361S	unknown	Het
Pik3r6	A	G	11: 68,543,629	E552G	probably damaging	Het
Pitx2	A	G	3: 129,215,872	T147A	probably benign	Het
Pkmyt1	G	A	17: 23,734,193	G241D	probably damaging	Het
Pola2	A	T	19: 5,953,774	V191D	possibly damaging	Het
Ralgapb	T	A	2: 158,449,447		probably null	Het
Rapgef4	T	C	2: 71,981,317	S11P	probably benign	Het
Rnf10	G	A	5: 115,257,077	R151C	probably damaging	Het
Rpl34	G	A	3: 130,729,067	P50L	probably benign	Het
Rptn	C	G	3: 93,398,130	H923Q	possibly damaging	Het
Sbno2	A	T	10: 80,060,016	L977Q	probably damaging	Het
Sec14l3	G	A	11: 4,075,566		probably null	Het
Serping1	A	T	2: 84,770,268	N243K	possibly damaging	Het
Slco2b1	T	A	7: 99,685,572	I231F	probably damaging	Het
Spag8	A	G	4: 43,652,458	F294S	probably damaging	Het
Speer4f1	G	A	5: 17,479,495	A174T	probably damaging	Het
Spred3	T	C	7: 29,162,977	D147G	probably benign	Het
Stard9	A	G	2: 120,696,760	D1166G	probably damaging	Het
Svep1	G	T	4: 58,104,536	T1229K	possibly damaging	Het
Tanc1	T	A	2: 59,838,961		probably null	Het
Tmem232	T	C	17: 65,430,805	Y420C	probably damaging	Het
Tubd1	A	T	11: 86,557,793	M311L	probably benign	Het
Tulp3	G	A	6: 128,355,740		probably null	Het
Usp42	T	C	5: 143,717,187	T560A	possibly damaging	Het
Vmn1r170	A	T	7: 23,606,509	Y112F	probably damaging	Het
Vmn2r4	A	T	3: 64,415,278	C7S	probably benign	Het
Wrn	A	G	8: 33,284,654	M652T	probably benign	Het
Wsb1	G	A	11: 79,248,510	P120L	possibly damaging	Het
Zfp142	T	C	1: 74,570,508	E1376G	probably damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTAAAGCTGTTTCAGGAGAGG -3'
(R):5'- TCGTTTGCCCCGAAAGATTATG -3'

Sequencing Primer
(F):5'- CTTCTTTCTGAGAGGTGACCAGAG -3'
(R):5'- CGTTTGCCCCGAAAGATTATGATTAG -3'

Posted On

2018-02-27