Incidental Mutation 'R6193:Cyp27a1'
ID 502686
Institutional Source Beutler Lab
Gene Symbol Cyp27a1
Ensembl Gene ENSMUSG00000026170
Gene Name cytochrome P450, family 27, subfamily a, polypeptide 1
Synonyms cholesterol 27 hydroxylase, Cyp27, 1300013A03Rik
MMRRC Submission 044333-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R6193 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74713574-74737892 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74737072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 416 (I416V)
Ref Sequence ENSEMBL: ENSMUSP00000027356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356] [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
AlphaFold Q9DBG1
Predicted Effect probably benign
Transcript: ENSMUST00000027356
AA Change: I416V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170
AA Change: I416V

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081636
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113672
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160732
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162093
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188073
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190781
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null allele show hepato- and adrenomegaly, reduced bile acid synthesis, increased cholesterol 7alpha-hydroxylase activity and 7alpha-hydroxycholesterol levels, slightly higher 25-hydroxyvitamin D levels, and altered hepatic fatty acid, triacylglycerol, and adrenal cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,920,780 I106T probably benign Het
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Cplx2 C T 13: 54,379,593 P97S probably damaging Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Olfr392 T A 11: 73,814,824 H86L probably benign Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Pla2g4a T C 1: 149,902,430 D5G probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Prss2 T G 6: 41,521,820 I6S unknown Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Vmn2r115 T C 17: 23,357,009 F527S probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in Cyp27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cyp27a1 APN 1 74731938 missense possibly damaging 0.88
IGL01824:Cyp27a1 APN 1 74735881 nonsense probably null
IGL02725:Cyp27a1 APN 1 74735703 missense probably damaging 0.98
IGL02966:Cyp27a1 APN 1 74732090 missense probably benign
IGL03067:Cyp27a1 APN 1 74731909 splice site probably null
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R1968:Cyp27a1 UTSW 1 74737276 missense probably benign 0.00
R2271:Cyp27a1 UTSW 1 74736687 missense probably damaging 1.00
R3847:Cyp27a1 UTSW 1 74737559 missense probably damaging 0.99
R4735:Cyp27a1 UTSW 1 74737207 missense possibly damaging 0.94
R4936:Cyp27a1 UTSW 1 74735405 missense probably benign 0.35
R5849:Cyp27a1 UTSW 1 74736684 missense probably damaging 1.00
R6129:Cyp27a1 UTSW 1 74735692 missense probably benign 0.24
R6344:Cyp27a1 UTSW 1 74736849 critical splice donor site probably null
R6464:Cyp27a1 UTSW 1 74735888 missense possibly damaging 0.61
R7226:Cyp27a1 UTSW 1 74737348 missense probably damaging 1.00
R7337:Cyp27a1 UTSW 1 74735435 missense probably damaging 1.00
R7696:Cyp27a1 UTSW 1 74732039 missense probably benign 0.00
R7959:Cyp27a1 UTSW 1 74737077 missense probably benign 0.07
R8258:Cyp27a1 UTSW 1 74732055 missense probably benign 0.22
R8259:Cyp27a1 UTSW 1 74732055 missense probably benign 0.22
R9352:Cyp27a1 UTSW 1 74713761 missense possibly damaging 0.92
Z1177:Cyp27a1 UTSW 1 74737335 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGGAGACCCTGCGGTAG -3'
(R):5'- GTTGGGCTCAGGAAAGACACTG -3'

Sequencing Primer
(F):5'- TATGATCCCATGCGCATAGG -3'
(R):5'- CTCAGGAAAGACACTGGGATCC -3'
Posted On 2018-02-27