Incidental Mutation 'R6193:Clca3a1'
ID 502698
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 044333-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6193 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144464993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect probably benign
Transcript: ENSMUST00000029932
AA Change: V80A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: V80A

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059091
AA Change: V80A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: V80A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,792,629 (GRCm39) I106T probably benign Het
Aagab A C 9: 63,524,795 (GRCm39) N35H possibly damaging Het
Abcf1 A C 17: 36,274,464 (GRCm39) N161K possibly damaging Het
Adam11 T A 11: 102,662,087 (GRCm39) H140Q probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Arhgef26 A T 3: 62,247,213 (GRCm39) D99V possibly damaging Het
Arhgef28 A G 13: 98,121,888 (GRCm39) S559P probably damaging Het
Capn11 A G 17: 45,964,430 (GRCm39) probably null Het
Ccdc157 T C 11: 4,101,912 (GRCm39) H3R probably damaging Het
Cd101 A G 3: 100,927,778 (GRCm39) L101P probably damaging Het
Cnot6 T A 11: 49,570,850 (GRCm39) I381F probably benign Het
Cntn3 T A 6: 102,185,092 (GRCm39) I675F probably benign Het
Cplx2 C T 13: 54,527,406 (GRCm39) P97S probably damaging Het
Crtac1 T A 19: 42,312,236 (GRCm39) E159V possibly damaging Het
Cyp27a1 A G 1: 74,776,231 (GRCm39) I416V probably benign Het
Cyp2d37-ps T C 15: 82,574,014 (GRCm39) noncoding transcript Het
Cyp2d9 A G 15: 82,336,728 (GRCm39) T26A probably benign Het
Cyp2j7 T A 4: 96,083,440 (GRCm39) R503S probably damaging Het
Dclk1 A T 3: 55,424,292 (GRCm39) probably null Het
Dgkq A T 5: 108,803,366 (GRCm39) C231* probably null Het
Dync1i1 T A 6: 5,730,679 (GRCm39) M38K probably benign Het
Eif2ak4 C T 2: 118,231,081 (GRCm39) probably benign Het
Ephx2 A T 14: 66,326,961 (GRCm39) D411E probably benign Het
Ephx2 T G 14: 66,349,669 (GRCm39) Q34P probably benign Het
Fer1l5 A T 1: 36,448,517 (GRCm39) N1092Y probably benign Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Fzd4 A T 7: 89,057,197 (GRCm39) K415* probably null Het
Gfi1 A T 5: 107,869,397 (GRCm39) Y278N probably benign Het
Gm11565 T C 11: 99,806,070 (GRCm39) M154T probably benign Het
Gm7247 A G 14: 51,759,299 (GRCm39) I93V possibly damaging Het
Golm1 T G 13: 59,792,972 (GRCm39) I178L probably benign Het
Grip1 A T 10: 119,874,219 (GRCm39) D302V probably damaging Het
Gtf2h1 G A 7: 46,456,254 (GRCm39) probably null Het
Herc2 C A 7: 55,806,649 (GRCm39) P2372T probably damaging Het
Ighv1-59 C A 12: 115,298,786 (GRCm39) L89F probably damaging Het
Ighv7-4 G A 12: 114,186,445 (GRCm39) A109V possibly damaging Het
Kcnk10 G T 12: 98,407,031 (GRCm39) Q222K probably benign Het
Klra6 A T 6: 129,995,881 (GRCm39) M159K probably benign Het
Lzts3 T C 2: 130,479,306 (GRCm39) T36A probably damaging Het
Mgam T A 6: 40,724,854 (GRCm39) Y443* probably null Het
Mmp23 T A 4: 155,735,990 (GRCm39) M221L possibly damaging Het
Mmp7 T A 9: 7,695,519 (GRCm39) V132E probably damaging Het
Npas2 C A 1: 39,331,843 (GRCm39) T86N probably damaging Het
Or1e32 T A 11: 73,705,650 (GRCm39) H86L probably benign Het
Or5al7 C T 2: 85,992,628 (GRCm39) V222M possibly damaging Het
Papola A T 12: 105,786,605 (GRCm39) E103V probably benign Het
Parp9 A T 16: 35,767,921 (GRCm39) N34Y possibly damaging Het
Pcdh7 A G 5: 57,877,666 (GRCm39) D407G probably damaging Het
Pcdhb5 T G 18: 37,455,080 (GRCm39) Y487D probably damaging Het
Pira12 C G 7: 3,901,049 (GRCm39) probably null Het
Pla2g4a T C 1: 149,778,181 (GRCm39) D5G probably damaging Het
Plxnb1 T C 9: 108,933,971 (GRCm39) L733P probably benign Het
Ppfia4 T C 1: 134,251,899 (GRCm39) D425G probably benign Het
Prss2 T G 6: 41,498,754 (GRCm39) I6S unknown Het
Psme3ip1 A G 8: 95,302,348 (GRCm39) S228P probably damaging Het
Qrfprl T A 6: 65,433,142 (GRCm39) F321I probably damaging Het
Qrich2 T A 11: 116,344,979 (GRCm39) I1693L probably benign Het
Rad52 T C 6: 119,897,143 (GRCm39) V324A probably benign Het
Rapgef2 A T 3: 78,976,751 (GRCm39) Y1352N possibly damaging Het
Rsad2 T G 12: 26,506,186 (GRCm39) Y78S probably damaging Het
Scaf1 A G 7: 44,656,204 (GRCm39) probably benign Het
Sfxn5 T C 6: 85,246,918 (GRCm39) T131A probably damaging Het
Slc4a10 T G 2: 62,073,701 (GRCm39) probably null Het
Spmap2l A G 5: 77,164,183 (GRCm39) D62G possibly damaging Het
Syt1 A G 10: 108,336,597 (GRCm39) V357A probably benign Het
Tenm2 T A 11: 35,937,621 (GRCm39) D1685V probably damaging Het
Tmc3 A G 7: 83,252,543 (GRCm39) T315A probably benign Het
Tmem266 T C 9: 55,344,493 (GRCm39) L375P probably benign Het
Tsks T G 7: 44,603,263 (GRCm39) L355R probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ube2f T A 1: 91,203,041 (GRCm39) probably null Het
Usp37 A T 1: 74,532,087 (GRCm39) V102D probably damaging Het
Usp44 G A 10: 93,683,010 (GRCm39) probably benign Het
Vmn2r115 T C 17: 23,575,983 (GRCm39) F527S probably benign Het
Zfp101 A C 17: 33,600,720 (GRCm39) Y345* probably null Het
Zfp160 C A 17: 21,247,124 (GRCm39) A558E probably benign Het
Zfp236 T C 18: 82,622,372 (GRCm39) E1686G probably damaging Het
Zfp655 T A 5: 145,181,586 (GRCm39) D481E probably benign Het
Zswim4 A G 8: 84,952,774 (GRCm39) V396A probably benign Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2129:Clca3a1 UTSW 3 144,722,526 (GRCm39) missense probably damaging 1.00
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2238:Clca3a1 UTSW 3 144,457,766 (GRCm39) missense possibly damaging 0.94
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144,465,020 (GRCm39) missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7121:Clca3a1 UTSW 3 144,717,567 (GRCm39) missense probably damaging 1.00
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144,455,492 (GRCm39) missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGATGTGTACAAATAGTCCAC -3'
(R):5'- CACTTGAGGAAGAGGAGCCC -3'

Sequencing Primer
(F):5'- TGTGTACAAATAGTCCACACAAATG -3'
(R):5'- AAGAGGAGCCCCCGTTTG -3'
Posted On 2018-02-27