Incidental Mutation 'R6193:Prss2'
ID502708
Institutional Source Beutler Lab
Gene Symbol Prss2
Ensembl Gene ENSMUSG00000057163
Gene Nameprotease, serine 2
SynonymsTRYP, Tesp4, Ta, TRY8, Try2
MMRRC Submission 044333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6193 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location41521787-41525079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41521820 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 6 (I6S)
Ref Sequence ENSEMBL: ENSMUSP00000065393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070380]
Predicted Effect unknown
Transcript: ENSMUST00000070380
AA Change: I6S
SMART Domains Protein: ENSMUSP00000065393
Gene: ENSMUSG00000057163
AA Change: I6S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Tryp_SPc 23 239 5.29e-106 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the trypsin family of serine proteases and encodes anionic trypsinogen. It is part of a cluster of trypsinogen genes that are located within the T cell receptor beta locus. Enzymes of this family cleave peptide bonds that follow lysine or arginine residues. This protein is found at high levels in pancreatic juice and its upregulation is a characteristic feature of pancreatitis. This protein has also been found to activate pro-urokinase in ovarian tumors, suggesting a function in tumor invasion. In addition, this enzyme is able to cleave across the type II collagen triple helix in rheumatoid arthritis synovitis tissue, potentially participating in the degradation of type II collagen-rich cartilage matrix. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,920,780 I106T probably benign Het
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Cplx2 C T 13: 54,379,593 P97S probably damaging Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp27a1 A G 1: 74,737,072 I416V probably benign Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Olfr392 T A 11: 73,814,824 H86L probably benign Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Pla2g4a T C 1: 149,902,430 D5G probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Vmn2r115 T C 17: 23,357,009 F527S probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in Prss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Prss2 APN 6 41524543 missense possibly damaging 0.54
R2009:Prss2 UTSW 6 41523976 missense probably damaging 0.97
R4471:Prss2 UTSW 6 41522846 missense probably damaging 0.97
R5728:Prss2 UTSW 6 41523917 missense probably benign 0.29
R6243:Prss2 UTSW 6 41524453 missense probably benign 0.00
R7793:Prss2 UTSW 6 41524952 missense possibly damaging 0.56
R8463:Prss2 UTSW 6 41521805 start codon destroyed probably null
Z1177:Prss2 UTSW 6 41523880 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCTGATGCAAGACTCTGGG -3'
(R):5'- CTTGGCACCAATTAGAATGAAGAC -3'

Sequencing Primer
(F):5'- GAAAGAGAAACCTGCAGCTATGTTTG -3'
(R):5'- CACCAATTAGAATGAAGACTGGAGAC -3'
Posted On2018-02-27