Incidental Mutation 'R6193:Cplx2'
ID502743
Institutional Source Beutler Lab
Gene Symbol Cplx2
Ensembl Gene ENSMUSG00000025867
Gene Namecomplexin 2
Synonyms921-L
MMRRC Submission 044333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6193 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54371349-54383917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54379593 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 97 (P97S)
Ref Sequence ENSEMBL: ENSMUSP00000026985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026985]
Predicted Effect probably damaging
Transcript: ENSMUST00000026985
AA Change: P97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026985
Gene: ENSMUSG00000025867
AA Change: P97S

DomainStartEndE-ValueType
Pfam:Synaphin 1 133 3.1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a variety of neurological abnormalities related to coordination, learning, and social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,920,780 I106T probably benign Het
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp27a1 A G 1: 74,737,072 I416V probably benign Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Olfr392 T A 11: 73,814,824 H86L probably benign Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Pla2g4a T C 1: 149,902,430 D5G probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Prss2 T G 6: 41,521,820 I6S unknown Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Vmn2r115 T C 17: 23,357,009 F527S probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in Cplx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1239:Cplx2 UTSW 13 54379602 missense probably damaging 0.99
R4280:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4283:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4362:Cplx2 UTSW 13 54378817 missense probably benign 0.02
R4363:Cplx2 UTSW 13 54378817 missense probably benign 0.02
R4649:Cplx2 UTSW 13 54379548 missense probably benign 0.14
R4965:Cplx2 UTSW 13 54379647 missense possibly damaging 0.95
R5165:Cplx2 UTSW 13 54378976 missense possibly damaging 0.80
R5465:Cplx2 UTSW 13 54379539 missense possibly damaging 0.95
R6642:Cplx2 UTSW 13 54378923 missense probably damaging 0.98
R7361:Cplx2 UTSW 13 54378826 missense probably benign 0.06
R7422:Cplx2 UTSW 13 54378850 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCACCTGCTAAAGACTGGGC -3'
(R):5'- TCCCCTTTGGAACTGAGACTTAAC -3'

Sequencing Primer
(F):5'- TTCTCCAGGGAAGGCAGCTTTC -3'
(R):5'- TTGAACATGTCCTGCAGC -3'
Posted On2018-02-27