Incidental Mutation 'R6193:Golm1'
ID 502744
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Name golgi membrane protein 1
Synonyms Golph2, 2310001L02Rik, D030064E01Rik, PSEC0257, GP73
MMRRC Submission 044333-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6193 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59782810-59823598 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 59792972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 178 (I178L)
Ref Sequence ENSEMBL: ENSMUSP00000093410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]
AlphaFold Q91XA2
Predicted Effect probably benign
Transcript: ENSMUST00000022039
AA Change: I178L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: I178L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095739
AA Change: I178L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: I178L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225333
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,792,629 (GRCm39) I106T probably benign Het
Aagab A C 9: 63,524,795 (GRCm39) N35H possibly damaging Het
Abcf1 A C 17: 36,274,464 (GRCm39) N161K possibly damaging Het
Adam11 T A 11: 102,662,087 (GRCm39) H140Q probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Arhgef26 A T 3: 62,247,213 (GRCm39) D99V possibly damaging Het
Arhgef28 A G 13: 98,121,888 (GRCm39) S559P probably damaging Het
Capn11 A G 17: 45,964,430 (GRCm39) probably null Het
Ccdc157 T C 11: 4,101,912 (GRCm39) H3R probably damaging Het
Cd101 A G 3: 100,927,778 (GRCm39) L101P probably damaging Het
Clca3a1 A G 3: 144,464,993 (GRCm39) V80A possibly damaging Het
Cnot6 T A 11: 49,570,850 (GRCm39) I381F probably benign Het
Cntn3 T A 6: 102,185,092 (GRCm39) I675F probably benign Het
Cplx2 C T 13: 54,527,406 (GRCm39) P97S probably damaging Het
Crtac1 T A 19: 42,312,236 (GRCm39) E159V possibly damaging Het
Cyp27a1 A G 1: 74,776,231 (GRCm39) I416V probably benign Het
Cyp2d37-ps T C 15: 82,574,014 (GRCm39) noncoding transcript Het
Cyp2d9 A G 15: 82,336,728 (GRCm39) T26A probably benign Het
Cyp2j7 T A 4: 96,083,440 (GRCm39) R503S probably damaging Het
Dclk1 A T 3: 55,424,292 (GRCm39) probably null Het
Dgkq A T 5: 108,803,366 (GRCm39) C231* probably null Het
Dync1i1 T A 6: 5,730,679 (GRCm39) M38K probably benign Het
Eif2ak4 C T 2: 118,231,081 (GRCm39) probably benign Het
Ephx2 A T 14: 66,326,961 (GRCm39) D411E probably benign Het
Ephx2 T G 14: 66,349,669 (GRCm39) Q34P probably benign Het
Fer1l5 A T 1: 36,448,517 (GRCm39) N1092Y probably benign Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Fzd4 A T 7: 89,057,197 (GRCm39) K415* probably null Het
Gfi1 A T 5: 107,869,397 (GRCm39) Y278N probably benign Het
Gm11565 T C 11: 99,806,070 (GRCm39) M154T probably benign Het
Gm7247 A G 14: 51,759,299 (GRCm39) I93V possibly damaging Het
Grip1 A T 10: 119,874,219 (GRCm39) D302V probably damaging Het
Gtf2h1 G A 7: 46,456,254 (GRCm39) probably null Het
Herc2 C A 7: 55,806,649 (GRCm39) P2372T probably damaging Het
Ighv1-59 C A 12: 115,298,786 (GRCm39) L89F probably damaging Het
Ighv7-4 G A 12: 114,186,445 (GRCm39) A109V possibly damaging Het
Kcnk10 G T 12: 98,407,031 (GRCm39) Q222K probably benign Het
Klra6 A T 6: 129,995,881 (GRCm39) M159K probably benign Het
Lzts3 T C 2: 130,479,306 (GRCm39) T36A probably damaging Het
Mgam T A 6: 40,724,854 (GRCm39) Y443* probably null Het
Mmp23 T A 4: 155,735,990 (GRCm39) M221L possibly damaging Het
Mmp7 T A 9: 7,695,519 (GRCm39) V132E probably damaging Het
Npas2 C A 1: 39,331,843 (GRCm39) T86N probably damaging Het
Or1e32 T A 11: 73,705,650 (GRCm39) H86L probably benign Het
Or5al7 C T 2: 85,992,628 (GRCm39) V222M possibly damaging Het
Papola A T 12: 105,786,605 (GRCm39) E103V probably benign Het
Parp9 A T 16: 35,767,921 (GRCm39) N34Y possibly damaging Het
Pcdh7 A G 5: 57,877,666 (GRCm39) D407G probably damaging Het
Pcdhb5 T G 18: 37,455,080 (GRCm39) Y487D probably damaging Het
Pira12 C G 7: 3,901,049 (GRCm39) probably null Het
Pla2g4a T C 1: 149,778,181 (GRCm39) D5G probably damaging Het
Plxnb1 T C 9: 108,933,971 (GRCm39) L733P probably benign Het
Ppfia4 T C 1: 134,251,899 (GRCm39) D425G probably benign Het
Prss2 T G 6: 41,498,754 (GRCm39) I6S unknown Het
Psme3ip1 A G 8: 95,302,348 (GRCm39) S228P probably damaging Het
Qrfprl T A 6: 65,433,142 (GRCm39) F321I probably damaging Het
Qrich2 T A 11: 116,344,979 (GRCm39) I1693L probably benign Het
Rad52 T C 6: 119,897,143 (GRCm39) V324A probably benign Het
Rapgef2 A T 3: 78,976,751 (GRCm39) Y1352N possibly damaging Het
Rsad2 T G 12: 26,506,186 (GRCm39) Y78S probably damaging Het
Scaf1 A G 7: 44,656,204 (GRCm39) probably benign Het
Sfxn5 T C 6: 85,246,918 (GRCm39) T131A probably damaging Het
Slc4a10 T G 2: 62,073,701 (GRCm39) probably null Het
Spmap2l A G 5: 77,164,183 (GRCm39) D62G possibly damaging Het
Syt1 A G 10: 108,336,597 (GRCm39) V357A probably benign Het
Tenm2 T A 11: 35,937,621 (GRCm39) D1685V probably damaging Het
Tmc3 A G 7: 83,252,543 (GRCm39) T315A probably benign Het
Tmem266 T C 9: 55,344,493 (GRCm39) L375P probably benign Het
Tsks T G 7: 44,603,263 (GRCm39) L355R probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ube2f T A 1: 91,203,041 (GRCm39) probably null Het
Usp37 A T 1: 74,532,087 (GRCm39) V102D probably damaging Het
Usp44 G A 10: 93,683,010 (GRCm39) probably benign Het
Vmn2r115 T C 17: 23,575,983 (GRCm39) F527S probably benign Het
Zfp101 A C 17: 33,600,720 (GRCm39) Y345* probably null Het
Zfp160 C A 17: 21,247,124 (GRCm39) A558E probably benign Het
Zfp236 T C 18: 82,622,372 (GRCm39) E1686G probably damaging Het
Zfp655 T A 5: 145,181,586 (GRCm39) D481E probably benign Het
Zswim4 A G 8: 84,952,774 (GRCm39) V396A probably benign Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59,797,470 (GRCm39) missense probably damaging 0.99
IGL01327:Golm1 APN 13 59,792,958 (GRCm39) missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59,786,191 (GRCm39) missense probably benign 0.00
R0047:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign 0.03
R0047:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign 0.03
R0458:Golm1 UTSW 13 59,812,178 (GRCm39) missense probably damaging 0.98
R0989:Golm1 UTSW 13 59,787,997 (GRCm39) missense probably benign 0.01
R1301:Golm1 UTSW 13 59,786,187 (GRCm39) missense probably damaging 0.99
R1804:Golm1 UTSW 13 59,790,203 (GRCm39) critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59,790,065 (GRCm39) missense probably benign 0.04
R1940:Golm1 UTSW 13 59,790,051 (GRCm39) splice site probably benign
R2086:Golm1 UTSW 13 59,792,999 (GRCm39) nonsense probably null
R2513:Golm1 UTSW 13 59,790,072 (GRCm39) missense probably benign 0.01
R2887:Golm1 UTSW 13 59,788,044 (GRCm39) missense probably benign 0.00
R3903:Golm1 UTSW 13 59,786,154 (GRCm39) missense probably damaging 1.00
R4154:Golm1 UTSW 13 59,790,167 (GRCm39) missense probably benign 0.01
R5580:Golm1 UTSW 13 59,790,179 (GRCm39) missense probably benign 0.03
R6418:Golm1 UTSW 13 59,813,375 (GRCm39) missense probably damaging 1.00
R6594:Golm1 UTSW 13 59,812,041 (GRCm39) missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59,786,197 (GRCm39) missense probably damaging 1.00
R6967:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6968:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6991:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6992:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6993:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6996:Golm1 UTSW 13 59,790,058 (GRCm39) missense probably benign 0.00
R7576:Golm1 UTSW 13 59,792,920 (GRCm39) missense probably benign 0.00
R7692:Golm1 UTSW 13 59,788,071 (GRCm39) missense probably benign 0.08
R7863:Golm1 UTSW 13 59,797,383 (GRCm39) missense probably damaging 1.00
R7948:Golm1 UTSW 13 59,812,011 (GRCm39) critical splice donor site probably null
R9519:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign
R9703:Golm1 UTSW 13 59,797,433 (GRCm39) missense probably benign 0.39
X0026:Golm1 UTSW 13 59,786,127 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAGCTTTGCTCTGTTG -3'
(R):5'- GGTTGCAGATGGACACTTGC -3'

Sequencing Primer
(F):5'- TGCTCTGTTGTACCACAGAGAAC -3'
(R):5'- AGATGGACACTTGCCCTGGTAG -3'
Posted On 2018-02-27