Incidental Mutation 'R6193:A1bg'
ID502749
Institutional Source Beutler Lab
Gene Symbol A1bg
Ensembl Gene ENSMUSG00000022347
Gene Namealpha-1-B glycoprotein
SynonymsC44
MMRRC Submission 044333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6193 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location60896859-60923012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60920780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 106 (I106T)
Ref Sequence ENSEMBL: ENSMUSP00000094151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096418] [ENSMUST00000228632]
Predicted Effect probably benign
Transcript: ENSMUST00000096418
AA Change: I106T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094151
Gene: ENSMUSG00000022347
AA Change: I106T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG_like 34 109 1.09e2 SMART
Blast:IG_like 137 215 5e-15 BLAST
Pfam:Ig_2 223 314 8.8e-11 PFAM
IG 328 415 1.32e-3 SMART
IG_like 426 511 9.21e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228929
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Cplx2 C T 13: 54,379,593 P97S probably damaging Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp27a1 A G 1: 74,737,072 I416V probably benign Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Olfr392 T A 11: 73,814,824 H86L probably benign Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Pla2g4a T C 1: 149,902,430 D5G probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Prss2 T G 6: 41,521,820 I6S unknown Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Vmn2r115 T C 17: 23,357,009 F527S probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in A1bg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:A1bg APN 15 60921253 missense probably damaging 0.98
IGL01622:A1bg APN 15 60917893 missense possibly damaging 0.66
IGL01623:A1bg APN 15 60917893 missense possibly damaging 0.66
IGL03131:A1bg APN 15 60919756 missense probably damaging 1.00
IGL03162:A1bg APN 15 60919732 missense probably damaging 0.99
IGL03356:A1bg APN 15 60919888 missense probably benign 0.00
R0009:A1bg UTSW 15 60919633 unclassified probably benign
R0009:A1bg UTSW 15 60919633 unclassified probably benign
R0014:A1bg UTSW 15 60919732 missense probably damaging 0.99
R1084:A1bg UTSW 15 60918155 unclassified probably benign
R1199:A1bg UTSW 15 60919635 critical splice donor site probably null
R4212:A1bg UTSW 15 60919736 missense possibly damaging 0.91
R4543:A1bg UTSW 15 60917900 missense probably damaging 1.00
R4835:A1bg UTSW 15 60920251 missense probably benign 0.00
R5404:A1bg UTSW 15 60919696 missense probably benign 0.02
R5553:A1bg UTSW 15 60920841 missense probably damaging 0.98
R5580:A1bg UTSW 15 60919032 missense probably benign 0.09
R5583:A1bg UTSW 15 60921234 missense probably damaging 1.00
R5825:A1bg UTSW 15 60920127 nonsense probably null
R5937:A1bg UTSW 15 60919646 missense probably benign 0.22
R6021:A1bg UTSW 15 60919864 missense possibly damaging 0.84
R6565:A1bg UTSW 15 60920810 missense probably damaging 1.00
R6870:A1bg UTSW 15 60919715 missense probably damaging 1.00
R6939:A1bg UTSW 15 60920395 missense probably damaging 0.98
R8115:A1bg UTSW 15 60920147 missense probably benign 0.18
R8213:A1bg UTSW 15 60919756 missense probably damaging 1.00
Z1177:A1bg UTSW 15 60918074 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGGTCCCAAGAACTCAATGG -3'
(R):5'- AAACCTGACCCTGGTGTGTG -3'

Sequencing Primer
(F):5'- CACTTACAAGCCTCTAGGGG -3'
(R):5'- GCAGTTGATTTGCCGACTAAG -3'
Posted On2018-02-27